Description :
From Genome Similarity Track
Location :
Scaffold_898:1141- 4891
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_898-snap-gene-0.4Gene of unknown function

Sequence
3750 bases(100 bases per row)
ATGCCTCTGACTGCACGGTCATAGTCTCAGTCTTCTCCTGAGCAACCTCATTGTTCACATCTcGCCCAACGGCAGAATCAGGCGTCTCAAGAGTTGCAAC
AAATGCCTTCACCGAGCGCACTGGAGCTGGTTCATCGTGCTCATTCTGCTGTGGTTGAGCAACTGACTCGTTCAAATACTTGGGTGTTTCTtgAAGCTGC
GAAACGGAGTTGCCTtCCACCACAACGCTACTGATCCCCGAAGAGctCGCCTCCTCCACACTCAGCAGCTTGACTTCGGGTAGATGCATGGCCGAGACTG
TGCGGCTCCCACGCCCGCGGCGACCGGGCGGAAGCGGTCGCGACGCCATCTCCTTCACAGCCAagTTCCGTCCTTCGAATGATCGACTGAGGCCCAGACG
CCaTGCCATGTTGACACGCAACagCaCGACACATAATTTCCACCAATCAGCAaGAGGTTACACTGGGTACACTCCCTCTTGCCTACATGCCAGTACTTCA
ACAACCACTACTTTAGTACATACCAAaTAGAcACCACAaCaCGAGGGctgAactCgtAcaGCCAGGCCGTCGTGAGTTGTTACGGCTGCTCGGCGTTAGG
AGCGCCTATGGGAGACCCCTTCTCAGTCAGCGACACACCCTAGTACCACCAAACTGGTACACCGTACCAGTCGTTGCGTAGCCATGATGAAATGTATTGC
ATTAAAGGAATGCCTACGGGCTGAATGTCATAGGTCNNNNNNNNNNNNNNNNNNNNATTTCCACTTGGACCGGTGCCTGGGgTTtACCCTtAGTTGCGGC
ACGTGCTGCCGCTCGCTCTGCTCGACGTTCAGCTGTtGTCgCGGGGTCTaacaTCCTCGGTGGCCGAGAGgTGGATTGACCGAAGCGAGGCACCTACAAa
TGagCGcGgAAATCCGATGGAAGAAGCGAACGATGCTCTTTtAATCTGCCAGGCATACCAGTCCTGGGATGCCGACTCaCAAAaTATATCTGTACCGTTT
CATATTAGCAGGATATGTTaTATAGTTTTtCTTtAcTCATCATATACATATTtATTGCTGAAaCTAATCTAATGTATTATacAAAATATGACTATTGAGG
ATTCTAGatATCGGCAGATCGAAacTGGGGCCATGAAGAGTCGCGAGAGGCTAATGCGCAGTGAGCTGGAGCTcaaaCTCCAAGTGTTTCTATGCTCTTC
CTATCCTGCCACATACAaGCTGTATCATGTGCAACAGCGTTTGCACTACTCCTGGTCTGTGCGTGCGCCCAGCTCGTGCTGCAATCGACACTTCTCGTCC
catCGTTGGGCGGgTCTGGTACACGGGAAGAAGTTCcGCATCGACTCCTACTCTTCGCTCAGGATGAACCAGTGGACGTGCTCGAAGGCATCCGCAAGCA
GTATGGAGCGACCCGCGCGTGGCGCCACAACATCCTGACTCAAGTATGCCAGCGGCAGAACATCCAATGCTCGCGGGACCGGCCGCTCGTGTTCTCCACC
CGCATTACGGaCCAAGCGGGGGgCACCCTTGGCGACTTGGCAATTCTCGAAGACGACGAGCCTGTGGACGCTCTTGCACGGTTCAGTGTGCGAAAcGGGC
TCCCACGCAGTGCACGGATGCAAGTTCTCAGTGCGATATGTGGgAAAGTCCAATGCAAGCGCTACCGTtCTCGCATTTtCcACCAGCGCATTCTGGGCGA
CAAGGgTgAAGCTGATCCCGTTGGAGTTCtCGAAGTTTATGACGATGAAGAACCTATCGACCAGATCTACCGCTTTGTCtATGACAATAAGCTGCCTCAA
TCTGTGATGCACCAGCTCCTTGATGTGGTgTGcAACAACGTaCCGTGCGAACGAaGCAcGCCAaTGATGTtCTCGAGAGAGATCTCGaCTGCAGATGGGA
gAACGATCGGGCgACTCGAAGTGCCGCTGGGCCAGGAGGCTGCTGACGTTGTCTACGGTTTTGGACTCCAATACGGACTCGACAAGTCATTCCGACAGCA
GCTACTCCGTGTTGTGTGCGCTGACAaGtATGTCAAATGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATGCGAgCGGAaGTcGACCAT
CGTCTtCGAAGCTCCGATAGttGGGGAAaacAAcACAGCTCTtGgCACTCTTCGTATTGAAGAAGACcAGGAAGTTGCCGATGCAGTGTATCGCTTTGCG
TATGAACATGATCTCTCACGCGAGTTGCACGTAGCACTTCTTAGACAATTATGTGGCCGAGAAGGACTCGTGTGCACTCGAGGGCAGGCGCTGTTACGAT
CGATGCCTATTGCTGGTGGTGATGGTGGATCCCTTGGAACAGTTTACGTCTTTGAAGGTCAGGAGCCAGCAGATGTCGCGTACGATTTTGCAAAGCAGCA
TGGGCTGTCGGTgAACGCAGCTGATCGACTGGTTGATGTaCTTTGTGGTCTTGCAACGGACACCCCATTAGGGCCACAAGACTTGCCTATCAAGTGCTCT
CGTTTCTATCCTGTTGTATTCGCTGTGCCGGTTAGCGCTAACAATGGTAGCAATTTGGGTATCTTGGAAGTCCTCACAAACGACGAACCAGCAGACGCAG
TCGCACGATTTGGCAACAAGCATGGTCTTGGTAAGGAAGAAAAGGCAAATTTACTGAAGGCGATCTGTCAGAACAGTGgaCTACCGTGCAATCGAGACCA
AGGACTGATTTACCAAGGTGTCTACACACTTCCAGATGGTCAGCAAGAGCGCATTGACTTCATGGACGGAGTAGAGCCGACGGATCTCATTTACGACTAT
GGCAAACTCCGCAATTtGACTCACCACCAACGGAAAAAaTTCCTTATCGAAGTTTGTAATGAGCCTAGGCGTCGACCAAATTGCACTCGTGCTGAGCCGA
TGCTGATTAGCATTCCAGTGTGGGAGAGTGCTGACAAGAAGATGGGGGATTTAGATATTCTGGAGGGACAAGATCCAATCGATATGGTGTaCGCGTTCAT
GGACAAGCACGATTTATTCCAGACAGCCCCACTCAACACTACGCTCAAAGAAGTCGTTtGTAACAGTACGCGAGTCACTTGCACGCCACACCAGCCACGC
CGCATCTtGTTCACAATGCAAGCGACGTACTATGGGATCTCACACACCCTGCAGTATGTACAGCAAGAGTCTGACTGGATatGTGAATCACTTCCGCACG
GTGGCAAAAAGTGTGTGCACTATATGGAAGTACTGAGCAAAGGATTCTGTGAGACGCACATGACTGACTGGGTAGGATGCGAAGCGCGAATTCTACAGGC
TGTCCGTCAACAGCTGGAGCTGTATGAAGAACGCATGTGGCGAGGGAAAGACCTTTATGCCAAGCTAGGCCTCGTGAAGACGGCTACCAAGGACGAGATC
GATGCTGCaTACAATCGTCTTGTCAAGCGcTtCAATAATGAGACTGAGCCCCAAAAGTACGAGAAACTACGCGAAGCGTACGCTACACTGAGTGACCCAG
AAGACAAGTATTACTACGATCTGCCGTGCGTCAAACTGTTCGGTTGTCTATGTGGCAAGCGAAAGAAaGATGGATCATTAACGTTTACGACCGACTAGGG
ATACTTGCATAACCAGAAATAGAGGTGCTGCAGGTGAGCTTGATAGACAA