Description :
From Genome Similarity Track
Location :
Scaffold_1255:1141- 3716
Sequence
2575 bases(100 bases per row)
GACGTTCATGATCTAGTCCCCGGTGGAAGGCAGTGCTTCGGATTGCGCTGCAGGAGTTGGTCGAGGGACATTTTGACCTCGACATCCTGCTAGACCCCTT
CTTCCTGNNNNNNNNNNTCCCGGACGCTAGAAAAAATGCCTGGGGCATCCGGATTCCGGCTGTCAACAAACCGACATCCTCAATTTGGCTTCCTCCCTGC
GATTGACGGACTCCGCTGATCCCTGGCGTATTTAAATCGTAAGGCAATCGCCGATCACCCGAAATCTTCCATCGACTGACTCAAGAACAAGTTCTTGGAG
ATGTGATTTGTCGTTTCTTGTAGAAAGGACCACGGTGTTTATGACCGCAGTCGTGACCTCCAGTCGTAACTACTAAATTCGCCTTCATTGTACTTCATTA
ACTTTTCACATTCCATAATCATTACGCTCGTTAACTGTGTAATTCCTCCTGATGGCCAGCTCGCGTGGTCATTGTTCTTTCCGCTCACGAACCAGACGAT
CACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTGCATCACTTCCAATCGATTCCGATT
AGCGCCATCACGTTCAAATTTTTGTAACAATGCACTACAATTGAGGTTCTCTTCATCCACACATGTTTCATCACTATGACCCTTCCACCGGACTAGAAAN
NNNNNNNNNGTCCCGATTGTACAAATCTAATACTGTCCACCTCGTATTGACCTTCAGCCAAATTGTCTCCCCAATTGTCCTCCGGCAGTAGGGCTTTATC
GAAATCCACTCTTTTGGTTTCTTCCACCTCCANNNNNNNNNNNNNNNNNNCCGTGCAACAGGTCTATCAAGAATTTTTTTTACCAATTTCAGCTTAGATA
TGTGCACGAGTGGAATAGTTGGTATGGGGTTTCTTACACTTCCAGCCATACTTCTTGTTCCTCGCACTTCTCGATCACCCGAAATGGGCCATGCCNNNNN
NNNNNNNNCTGGTATATTCTTCTTCACTCAATTCAAATACAGCCGCACTTAGCTACCACAGCTTATTCCATGTGGACCTTGACCATAGGTGTGTTGATCA
GCCCTGTCCTGAATAGCCTCTATCAGCGGGTCATTCACGGTGACCCGGGCGCGTTGGTACGGTCGCTATATATGGTAACGCCATCTTCGCAAACAATCTA
CTGATGAGATGATCTGTAAACTGGAACCAGGATTAAGGGATGTCCGAGGGAAGCTTTTACGTTTAAATAAAAGACGGACGCTAAAATTACAAGGTCAGAG
TTGAGCATCACAATATTTAAGCATCGACGAACATGGCCGGGCACCCAGGCTCTCGTATAATGACAGATTATGGGGTCACGATCACGTGTTTTAGTGCATT
CCAACGGAAGGGTTGCTTCCAATGTCGACGCGGGTCCCATACATGGATGAGATAGACTGGAGTATCACCTCGGACTCGATCATGCGTCGTATTAATGGCG
AAGGTCAATCGCTCGTCATAATCATCCCAGTCTTGTTGGTTCACATCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGTAGTACGTTGCTTTTGACTGGCAATACGGTTGAACGCGCGAAAGAAATACGACATGAACCCAGG
GTCGCGATCATGCCGAATAGATTCGCTCGCCCCAAATCGCCAGAAGACNNNNNNNNNNCCCTTCCGCAAATTTTTGGGCCGTTCTCGAAGAGCTAGCCTT
AGCAATCACGTATCCAGAAAACATATCAACCCAAAGAGGCAATTCCGTTATTCCATTGAATTACCATGGCAGGGAGGAATTATAATCCATTGTAATAATA
TGAAAAGGATACGTAGCTTACATGCTTACCAGATATTCTCCACGTAGCACCGGACATGACTTCCCGGTTTTGCAGTCGACACACTTCNNNNNNNNNNNNN
NTGCACGCTTGGGAAGAGACCTCTCCAATGGAAGTGTTATCGCACGCGATGATACGTGCGGTCCACCCCTTGTTGACCCCCTTCCAGACTTGCATGATAA
TGGTGTAGAATATCATCTTGGAGCAGCTCCAGTATCACCAAACGAACGAGCTCAACACGATCATCGGAATTTGTCGCAGATTGCGGGCAAAACTGCAACA
ATCCTTCTTCATCTACCACGTAGTCTGGGGCAATTACGGCACTTGATTTTGCTTTTACAGCTCCCAGCTTGGTTATATCTCTGACTAAGTAAAGCTTGAG
GTTAGCGATCCAACTTTCCTTGTCTTACGTCTGTTTTATACGGTCGAGTCGCATCTGCTGTACTACTTATTTTTATATAATGGTAGGTCCTCACGTCTTC
CCAAAGTCGACCGCGTAATTGCCGCCAGCTTAATCACTTGATCATTGCACGCAGGCGTCAATATTTCGTCCAGTCGATTGATGTCGCTCAGATCGTGGCA
ATCCTGATCAGTTAGAATGACTATTCCCTTTCCATCTGTAAAGCGGTGCTAGCCAATCGATCCGCGCTTTGATTC