Description :
From Genome Similarity Track
Location :
Scaffold_631:1141- 2979
Transcript NameFunction/comments
Phyra_86344Hypothetical protein

Sequence
1838 bases(100 bases per row)
GCAACTACCACCGCCTGCGCGCCAACGCCAACCAGCGCAAACTCGACCGCAAGAAGAAGGAGCAGCGCCTGCAGCAGCAACTCACGGCCGGCGCGTCCTC
ACCAATGAAACAGCCGATCCTCGCTTCTTCACATGCCGCGGCGGCGGCGCTGGCCTCGCTTGTAGCCGCGCAGCCGCAGCACCACTTCGACGTGCTGCAG
CAGAGATCGTTCTTCGCCGCGGGCGTGACCGTGCCGGACGTCGCAGCCATCGACAAGACCAATAGGAATAGAAGCACCAGCTGTGTGCGCCCCAAGCAGG
AAGACGCCTGCAGTTATTAGACTCACCATGGACCAGCAGGAGCGGCATTTTGCGAGCCACGCATTACCTGCAACCATAGACAACATAAACAGATAAACAG
AGCACCAAACGAACCACGATGGCACCTCAAGGCAAGGCATCGTGCATGCTACAGTACATAGTTATTGGAGTGCTCTAGCGTCGTGTGTGCAGACGTAGCT
GCGTGGGTGCGTTAGCTTACCATGACACGCGCTTCATATCGAAGTCTGGCGATGAAATCGGTATCTCGTTATGTGTACACGACCAAGAAGACCATGACAA
CGAGTACTGCCACCAGGAAGAGAATTAGCCCAAGCTGGCACTTGTCTGAAGCACAAGCAAACACACACGACGCTTTAGTACTTCGCCACTGCGGACGCTA
CAAAAAATGAAATCGCGCTCACCTTTCGTCTTGAGAAGTTTGCTCAAGCGGCCCATGACAAAGTTCATCCGCTCCTGAGCTTCCTCCACGTCGTCGTTCA
AATCGTCTAGCATTCTGCGTGATAACGAGGTTAGGAACAATTCTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN