Description :
From Genome Similarity Track
Location :
scaffold_250:11409- 14559
Transcript NameFunction/comments
g6305.t1hypothetical protein

Sequence
3150 bases(100 bases per row)
GCGATCGGTTAGGCCGGATACGATGCTGCTTCCCATCTGGTGGTCAAGCTTCAGTGGACCCCGTCAACCTTTGACTGCATCCCTCGACTTGCGTTCGTCT
CCGTTTGTGCCGTGAAGCTGCGGTGTCACGGCTTGCTGAGCAACATCCTGCAGCGGCAAATTTCGTCGACACTTCTCGCTCCGGACGCTCCAGCCTTCGA
CCAACGTGCCGGTCATGCATTTCCTTGAGCAGACCGCGGAGATCAGAGAGCCTTGAGCGTCAGACTTGGACTCAAAGAGAGCTTCGCCATGGAGCTGGCC
AGGCGTCAACACTTGCGTCGTGTCTTGTCGTACCCATCCCCCGAGCGCTGGTCAACGAACCTCCGCAGGCGCTCAACAAACCGTTGAGCGCTCACGCCAC
GGACCAGCTCGACGAGTGGTCTGCGCTCGGCAGCACCGTTGGCCCAAGTTCGGCGCCGTCGTGACTGCCCCATCTCGGTGCAGCGGGATCTTCTTTGGGC
CCAAATGACTGCCGTGCGGAGAGTAAAGTTACCTCGTCAAACAGGAGTTCTTGGGTGCTTTTCTGGTGCTTTTTAACTTCATTTTCGCGTTGCATCCTCG
CGATGAACTCCCTCCTCTCCTCGTTCACCTCAGATTTGCATGTACCTCTTGTCGAGGCGTTAATCCTTGATTCAATTGCTGTGTTGCCGTAGAACCTAAG
GCCAAGTGTAGGTCTACATTATCCAGTGTAGATGGTGTCGGGATAGTCGAAAATGATAATTGGCATACAAATAACAAGTGTAACTACTGAGTCTGGATCA
CTTGCTATTTGTATGTCTGACTCTCAATTACTTGAAGTTGGTATCCGACACAGATACTATTAAAAAACAGCGGAGACTTTCGTCGCCGAAAGCTCGTCAA
GAGTTCACTTTGTCATGGCCCCACTCTGCTCATCCTCCTGCACTATCCGGTTCTCGCCTGCCCTTGCGCCTGTATCACTGACGTGGTCGTGGTCAAGCAA
GCAAGGCGTCAAGCTATGGGTCAGCACCGCGTGTTCGCCTCGGAGCCTTTTCTGCATTGTTCGATCACCCGGGGAAGCCAAACTGTGTTAATGAGTAGTG
GCCACACGTCTTCACGGCGCTCCAACAGCTCGGACAGCGCCTCCACCGTCGCTGGACCGGTGAGCGTAGCAGGCACCACTAACGGCTATGGCTTCCGTAG
CGCCGGTGGCGATGCGTTGTCTATTGAAATGCAGTTCCTGAACCCGCGCCGGCGGTTCCCCCTCGCGGACGAGTTTCTGCCAGCTGTAAATGTGACGGAG
GAACAGGTGGAAGATCTTCGCGAGACGTGTGAGCAGCTCACAGCCGATGCGCTAGAGCTCGCCACCATGTTCGCGTGGGAGGACAGCAACAACAACGACC
TGGTGGGTGAGCACCGGGAGCAGTGGAAGGTGCACTACAAGAAGCCGCACGTGACGCTCTACCGGAAGAAGCGCGGCAAGGATGTGGCCGTAGATGAACA
GGAGGACGCCACAGATTCTACCAACGGCGGACTACGACACTACGTCGTTAGCGGACAGATCCACGACATGAGTCTCGAGGATGTCGAGTACGGACTCTAC
TGTGATGCCACGCTGGATGAACGCGCCGTCATGACGGACTTGTACCGTGAATTGTTCCTGGACGCAGCGGTTCTACGTAGTTTCGAGACACAGACGCCGG
AAGACCCGTTCCACTTCTTCGGAATCAAATGGCTGGCCCACTTGAGTCCAGCCGACAAGTTCATTTCGCCTCGTGACTTCGCCTTTGTCGAGTACTCGCG
GCGTGTAACCGGTCCCAAAGGCGAGCCGCTGCTTGTCAAGGTGCAGCAATCGCTCGGTCCCGAACACGTCGACGCCATGAACCGCCGTGAATTCGATCTC
GTGCGTGCTCGGATGAGCTGTACGACTGTGTACCGCCACGACAAGCGCGCTAACAACGTGCAGGTGATCGCTCGCGGCTACTTGGACCCGTGTGGGAGTG
CACCAGCTATAATGACGCGCTCCTTCCTGACACGCTTAGCGCCAACTCTTGTCGAGGTTGAACACAGCGCCGACGTCAAGTATATTATGCGCAATGGCTT
AGTACTGCCAAAAGAGCAGTTCTTCGCCCGCCGTAACGCTTTGAAGGCCCATGGACGTCACCGTCTACAATGTACAGCTTGTGGTAAACGCTTCGGTCGT
CTAAAGCGCCACTTGACTCAATGCCGCGCGTGTGGTGAAGCTGCGTGTGGTCGGTGTCTCATGACGTACACTTTGTGTCTTCCTCATCACGAGCACCGTA
GTGCGGAACACCCGAGTGCAGTGATCCCCGAACGCTTCTGTCTGCGTTGTCTGTATTCCGGTCGTCTTGATCGAAAAGGGCAACGCATGGACGACTTCCT
ACTTGGCGGAACGGTGGTCGCATCCACCACTGTGCCAACCGTTGACGACGACGACGAAGTTGACGATGACGACGAGTCTGTGGTGGAATTCGCGATGCTT
GGTGACGGCCCTGGAGCAATGCACGCTGCCATTTCGGAAGCGCAGCGCTTGCAGCGCCTGAAGCAGCGGTACCTGGAAAACGAGAAGCGCAAATACCTCA
GTGGACATCAACATACTCCAGTGCAGCGCTTTGTGGAGCAGCAGCACCAGATGCACCACTACGAGCAAGCGACGCGTAAAGCTCGTCCTCCAATTAGGAG
GAGCAGCCAGCCAACGCTGAATGGCAACAACTCGGTGAGTTCCTCCTCCGTCTCGTCAGCACACAACTCGGCTTCATCGATGTACAGTTCGCTGTCAATG
GGCAGCTCCTCCACGTACTCGTCAGCTGAAGCAGCGGCAGCAGCTACGGCAGCACTGCAAGCTAACACTGGTTTCCACGAGATGGAGCACTCTATCGGCC
AGCAAGAGGCGCTGTTGCGTTCGCTGCAGAGCGAGTACGCCAAGATGAGCATGAACAGAGCGCAGTCAAATCTGAGCTTCAATGCGCAGGAAATGCGAGA
AAAGCGTCTGGCCGAATGGCAGGCAGCTGAACGCTCGAATTCCACGCCAGCATCGATGTCCAACCAGTATTATGACATTGACGACTAAAGCGTCGTGAGT
AGTATTTTCTTTACAGCAGTGAGTGCGTGAACGTAGGTAGCTAGTATGGC