Description :
From Genome Similarity Track
Location :
scaffold_12:11407- 13939
Sequence
2532 bases(100 bases per row)
acacatgcggtCTCTGcggtctttaagacgaagctccgtccacggcttATCGTGCCGTTTTAAGTCGTGACAAAGCGAggtcttgcgtatacgctaaatt
cCGAAACAGATGCACACACCCGgtgtttatgtgggcttgttcaagccgtatcggggtccggagcaagtgaacgcggaagcgttggcgccggggcggcacc
caaaggcgcttaaccacccagaagctaaatcagcaactgattttgaGTACGAAGTGCAATTTCGGTTTCCAATAGCGCAAGGCGCTTCCCCGTCGCACGA
ACTGACGTACTTTTCAGCTCGACGGccaggagccgctccgacggAGCCCGATAAttttcaacgtgaggcagtcggtgcagcaatgctccaagctctcgag
gtcttccgcacagcggtatgcgacctcggcaagatgctcggtggagtgccgatgacaacGGACTTTGTCgtccaaagctcgaagagcatcgcgagtcacc
ggacggcgatcgaccaagtcgtcatcgtccgccaccgactcttctcaacAAGAACGGCGGTGTCCACTAAcatgtggaacgtcttgtggttcgacgtcgt
cgacagtgtcaaacccagtatctggTAACGTGGTGGGATGCCCAGACTCCGAGAGctcgtgagagtttgaggtgTCACTTCGGCAGGACTGCCCAAACGA
CGTgggcgcttatgatcagagggatcatgacgctccgtaTCGTCATACGCTTCGCGCTTCTTAGCAATAGCCACGGAAGCGGAAGGGCctggagctgagc
tcaagctatgatcCAgaactgctgtggtcgtagactcacccgcgtgagaaaccactgagctcgcggaagcgtgATGAATTGATCTagacgtcgcagggcg
acaatacaaaggctttgaatttggcaaactcgaaccggggatggcgttctacgcgtACGtctacctccttgtggctctaTTGTAAGtcagacagcgagga
aagtttccgatgccgctgcacccatcgctcaaagagctcatcatcatatGGAGCGGTTTCTCCTGGGGCAagtaccacaggaatcgcCCGTATGCGGTTC
CAGGAGCGTCTCTTCTTTTAGCGCGAAGCCGAGCGCGATACCTATCCATTAGGATATCTTGAGGCACCATGAAGCGATCTCAAAGAGcttccgctggtca
agctcagcttgtgcagTGGCTGGGggtccgactacgtagacgcctaacgatcgagtgattccgtcttttgcttctgtagcgggatccgccaagcggaagc
cgtattttaCATGAAGATATAGGACCGTCCGTGgatgcgagcgcatgagagccgccctgtgggcagcctccaactgcctcgtcgaggcgattggggGTAA
TTTACTCCACCTGGGAGTGGAGAGGTCAGGGGAACTgacacggcgtccgcaaggtttgagcagggctcacgttaCGATGTTGGCGCACCTTGTCCTCCTC
TTCGTCCCATCCTGGAAAAGGAGTattcgactcgtagtcgacttccttcgaatcctcgacaaggaaattcatcgcccgtggcgagcgcggtgtgtgtagc
gctcggttgccgagggcttgagatgtgctttccgtgaagccgcggacttACTGTCCGGGGATGCTcctcgtgcagaagaagaagtagGGCTTTGCCGTCG
TATTCAGCTTGGCTAGGTGTTTCTCGCGTCAtcgacacagggctcgtggagcggagaatgttcaaagATGTTCTTTGGGACGTGACGGTGTCTCAACACG
CGAGTCTCGTATTTGGAtgcagttaaatgtgaactgtggatattcacaattttgatggggggtgTAACGGAGCTACACGTACTCAGAGTGTAATGGGTCT
AAACCTACCCTAGTATGAAAGATTGTATCACACATgacggtgtgaccgtacaaaggtgtgtattacaagTTAGTGCCATCTTACaatggtgtgtattaca
AGTTAGTGCCATCTTACaacggtgtggctacaccgtaagttgaagccactacgtggcaggactgccagtagttatgcatattaattagattcTACTATTT
TATTAGGAAACCTAAGATTTTAGAAATTagacggctctgccgcaaaacaAACAACtaaatacaatttcaattttgaacaaaggAGTTTTTTTGCCTTGGT
GAAGGTTccgggtactcttggaggtccTCTCATACAAGgttatgtgtaaccccgttacatcatggacgcagtcgacgttgacatcttctgttgtaggtgc
tctagtggagcatttttatagctcGAAATCGCCTCTAGGAGCGCGCTGAtagcttcaggtccttgcgaagcgatgTGTTGCACGaactcagggccaagca
gaaacatcagctttttaagaccGTcccgcatgccctggggaaaATAGGAGAGCTgctctatcctcacagagaatcagtcgtATCGACTCGGGTGgatatt
gactacaagtgctaccaagtgcagcggggttg