Description :
From Genome Similarity Track
Location :
scaffold_5:114064- 116194
Transcript NameFunction/comments
g8120.t1 hypothetical protein PHYSODRAFT_248805
g8121.t1 hypothetical protein PHYSODRAFT_469105

Sequence
2130 bases(100 bases per row)
TGGAGGACTTTTCTGGAGAAGCTGCACTTCTTCTTGGAGTTCGAGACCGCGGGGGACGCGCTCGCGTGGCTTGAAGACGGCGCGCGCTTTATCGTTCATC
AAGGGGTCGAGGCCAGTCTCGAAGCGTGGCTGGGGCTTAGGGGTTGCTCGCTTCATCAGGTGCTGGAGGCGCTGAACTTCGACTGTCGAGAGGAGCTTCA
CTGGGAGCATTCGATCTATCGCCACGACAGCTTCGTTCGGGGGGACCCTGGCAAGATCACGGAGATGCTAGTCAATGATGCGCCGTTCCTCGGCAGCGAG
AAGGGTATGGCCATGCCCAGTGTCGCCTACAGCGCGGCGTTAAAGCCGCTGGAAGTTCGACTGAGTCTTCCCGAGTCGAACTCGCAGACTTGGGAGGTCA
CCGTCGCACCGAGCGTCCTGCCCCACCCAGGCATCGACGACAAAGGGGGTTTCCACTTTCAGGACTGTCTCGGTGTTGATAGCAGCATGGAAGAGAGCTC
CTTGGAAGAAATGTTTGACGACACGGACCGATTCAACAGCGACCACGACATGAAGTCGCCACTGTGGTGGTCTCAGCACAGTGACTTCTCCAGCATTTGC
ACGGATGATCTGTCCGACATGGATGCGCTCTCTCAGATCAGCGTGTTCTACGGATAGTGGGGCACGTATTTTTTTAAGAAACACCACTAACAGCCAGTTG
GCGCAGTAAAATCATCAAGGAGGCGGATTGAGAGAAATTGCGTACACTGGCCAAACGAGGCAGTAGTGTTGAAGTGAATATGCAGTTTTCCATCTACCTT
ACACAGAGTTTTTGCGCTGGAAACTTGTGGTTGAGTTGTCGGGGTCGGATCTCTCACCGCTCAGGCTTTCCTCCTCGGTCATTGCGCTACCGTGCACTGA
GTTCAGCGGGGCCGACGCCGACGGCACCACACCGTTAGAGTTTAGTGGCACCGCGCCGTCAGTCATGTCGCTCGAGACGTCAACTTCGTAGAAATCGTAG
ATGGTCTTGACAGTGACCTCCGAGTCCTTGTTGTTGATATCCTTGTGGTACGCCTCCAGGGTGAGCCAGAAGAGCGGCACGATATAGAGCGCAGAGAACA
CATCGATCGTGTAGTGCTTGCGCGAAGCCACGATCAGGAACGCGATCGCAATCTGCACGCACACCATGATGGTGATTCCGTACTTGTTGGGCCAGAACTT
CCAGACCGTGAGGATAAGCGACACCGTGTAGATCGTGTGGGAGCTGAACATCAAGTCGCCGCAACCGTTGAGAGAGTCGAGGCGGGTGAACCACTCGCTC
ACAGTGGGCGGGTTGAAGTCAGGGTTGGGAATAACGCAAGGGACCGGGTCGTCTGGGTTCGCCGCCAAGCACGTGTCGTCAAAATTGAGCTCGCAGTGCG
CGGCTGGGGACGGCAGCGCCGTCACGAGGAACGAAATGCAGCGGAAGACCAGACAGATGCTGAGCTGCAGCAGACAGCGCTTGAGCACGATCACCAGGTA
GCGCGGGCGGCCGGGCTCCTGCTTGAAGAGCGGGATGGTCAGCACCAGGATGATGGCTGGGCCAAAGACAGCGACGAACACGAGGATGTCCGAGAGCGAC
GCCGCGGTGCCGGTCAGCTCGGGCATGAGCTCGTAGCCCAGGTCGTAGAGCGTGAAACGCTGCTCCGTGGACAGGTAGTTGCCCTGGATGTAGTACGCCA
GGTTGTGGAAGATGGCGTGGACGTACTGCATGATGACGCACGGCAGGATGATCTTCCACTCGCGGGCCAACAGCTGCAGTTCGATCTTCACATAGTTGAT
GAAGTTCTGCTTGTCACGGAGCTGCCAGCGCCTCATAGTGTCGAGTGTTCTGTTTTGGGAGGAGACGGGAGGTAGCGACCGCGGAGGCTTCGCTTCGGAT
CAGACGGAACTGTGCACGGAGATAGGAGGATGGAGGCCAGGTGAGCTATTTTTTCGAGCTATGGACGCGGATTTCGACAGCGACCACGTACGTACCAGTG
TTTTCCGCTGCGTGCTGCCGCTCTGATTATCGAGTGGAGATCTGGAGCTCGAGTCGCTCGCCCTCCTCTTCCGCGAGCTGAACGTCCGCGGTCGGCCTGA
TGTTTGGTTGTGAGAAGCGGCCAAAAACGG