Description :
From Genome Similarity Track
Location :
scaffold_686:11406- 13605
Transcript NameFunction/comments
g9872.t1 conserved hypothetical protein
g9873.t1 croquemort-like mating protein M82, putative

Sequence
2199 bases(100 bases per row)
CCAAGGATTTTCAATTTTAGCTTTCGTAAAAAGTCATTTTTACATTTATAGTCACGTTAAAATGCGAAAACCTCTAAAGTAAGCTTCATAAATAGCTAAA
ATTCTGAATAGCCGGTACCTTCAGCGTAAACTACACCGTAAGTCGGTAAGAGATGACGTCGAGGATGTTGCGCATTCTGCTGCTGCTGGGCCTCGTAGCT
CTGCAGACACTGGGGGCCTCGGCCACTGCGTCGGTGTTCGATGCCGCTGCAAAGGAGGAGCAGGCGGCTGCTGCCAAGGAAAGGAACTCGCAGCGCAACA
TTGCGGACGACCAGGTTCAGGTGAGGTACTGTACTGCGTGCGGCTACCAGCAGAACTTCCAGCAGATCAAGACGTACTTGGAGGACACTTTCCCCCATCT
GGTGGACAGAGTCTACGGTAACAATTACGAAGTGGACCCATACAAGACGGTTGGTGGCATTTTTTCCTGTAAGGTGGACAGATACGACGGAAATGCTGAT
GAGAAATTGTCCTTGATTACATGTAGATGCTGGCGCACTTCTTGGGCTACGCACAGGCGACAGCGATGATTCTGTTGCTCTTTGGAGAATACGTACGTCA
TTTTCGGACCTTAAAACGTCTGAAGAGAGCTCTGGTTGATGACATTTTACTGCCTGGTGACAGATTCTGCCGGCGATTGGGGTGGACGTGGCGATGATTC
GCTGGGCGCGGGACAACCGCATCGCCGCCTTCTTCATTGTGCTGTTCATGGGGACTGCAGCTAGCAGTTTAACGGCGTCGGGGGCGTTCGAGATCTACTT
TAACGGTAGGAGGGAAACGTTAGTTTTTTTTGTGGATTGATCCAGTGCTGACTTGGGCGTGACGTTTGCAGACGACTTGATCTTCTCCAAGCTCGAGACT
GGACGCTGGCCAACGCTCCTAGTACGGTGCTGGAAGAGTGTGATCCCCGTGGTAGATCTGGTTACTGACTTGTGGCTTCTTCGTGTCGTGATGCAACAGG
AAATCTCGAACTCCATCAGCGAGTACGGACTGTTGGACAGCGCTGCTGCTTGAGTGTACCGGTAATGACTATCAGATAGTTTGACGGCATCAGGTTGTTG
CTGTCCTTCCGGGTAACCAACCTCATTCAAAAGACATGATCCTCCAGTAATCGCTACGTCAATATTAAGACCCCGGCGTCTTACAAGAACATTCAATCCT
GGAAAGTGTTTCATCTTCCTCGTCTTCTCGGAGTCTACACTAGTCGCACAGGCTCAGAGCCCCCGGTCGTCCCCGGCGTCACCGGCTGCATTTTGACCGG
TACTGCGACGATCTCTGGCGGTGGGGAGTCAGTTTGCCTGTACGCGTCGGAGCTCTGTCGTCTGGAGTCTTGTCCGCCAGTACAGCACGAAAAGCCTCGG
TCTCCGCAGCAGCACCTCGAGCAGTAGTCGCACATCGGGTAGCAGGTCACCTCAGCGCACGTGATGCAGCACCCGGCGCAGACTGCGCTCCAGCAGGCGC
CGCAGCAGTCGTCCATTCGTGCAGCTCCCAGTCCCGTGCACGCTTCAAAATCGGTTCTGCGGGACGGACGCGCACCCGTTCCGGCACCATCAGCAGCTCT
GAGATCGGATGTCCAACATTTTTCTTATGCTTCAGACGTGTAGCCATCTATTCCGTGTCCAACACGAACTACCGACAGATTCTGCGCCAATTCATGAAGA
GACTACGAAGATTAATCTCAAAAAGCTTTACGTAAACGTACAGGAGATATACATGAGCCCAGTACAGCTAACTACATGTAGTCCATGACTTAGATGACGC
TGCCGTAGCGTAGTTTCTCCATCTTGAGCTTGTGACGACGCCAGAGGTAGAGGCCGCCGCCCATCTCACCGATACCCACGATGATGAGCACAATGAGGCC
CGGCAGGAACGTCTTGACGAGCGTGAGCGTGCTCTTGAACGTGTCCAGCACGCTGTCCTTGGCTTCACCGGCTTCTTGCACCCAGTACGTGGGCAGAACC
ACCTCCGTCGGCAGCGTCGGCCACACCAGGTCGCTCATGGACGCGTTGGGTGCTGCACTTGAGGCTGCAATAGCGTACGAGATCTGTGACCGCTTGCGCG
CGCTCATGGTCTGACCCGTGCCCGACTCGATGTCGACAAAAGTGCCGTACGCACTGTGGACGTTCTCGAGCAGACTGCCGTCTGAATCGTACATACTGT