Description :
From Genome Similarity Track
Location :
Scaffold_643:11406- 23845
Transcript NameFunction/comments
Phyta_totarag9887conserved hypothetical protein
Phyta_totarag9888hypothetical protein PHYSODRAFT_466632
Phyta_totarag9889conserved hypothetical protein
Phyta_totarag9890hypothetical protein PHYSODRAFT_248463
Phyta_totarag9891hypothetical protein PHYSODRAFT_470700

Sequence
12439 bases(100 bases per row)
AAGACATGGCAAGCTCGTGGGATCGTTGGGCGGCCGTTGAGCGGATTCGGCGGCGCCCTCATGAGCCCGCCCCGGCGCGGCAGccgtcgtcctgcagcat
tCAACTTTTTCTAGCCGCAGTTGCTGTCACGTCAGTGACGAGTACACGGCGCTCTCTGCGCCGAATGGATCTTTTCTCTCAAGCGCAGCGAATGCGacgt
gcgctgctggagaggTGGGGCGATCCTGTAAGGCTGTTGCGCTCGCAACCAGCATCACGGTGAGTGAAAGGCGTCGCACAGTAAAAACCATCTTGGCATG
CAACATGTTTTCCCGGAAGTTGCCTATTGAGACCAGCCAATTGCGCTGTATTCACTATCGAAAGGTCATCCTAAAGTCATTTTACGTTGGTTTGCACATT
TTCTATTTATGCATTTCCGAAAGTATCAATTCAAACAGGTATCATTTTAGTCCAGTCCACCTCTTTCACCATAAGCTCATGCCCGGCCCCCTCTGGTCCG
CAGTCACCAACACGTCTCGTGCTGATGATGCTCCCTTGACGTGCCCCATGGTTCGtcgattgctgctgctgctcatgacGCTGACCTGCCTCAGCCACGT
CGGGGCGACTGGCGATGGCAACCCCACAGCTGTACGCCTCGTGACCGTCCACCCGCACAACGTCAGCGCGTTCACAGAAGGActcgtgttcgacgacgGC
GCGCTCATCGAGTCCACGGGACTCAACGGGGAGTCGTTCATCCGCAAGTACAAACTGTCGGACCTCAATGCCGACTTCTTCAAGGTGGAGGCCACGCAGG
CCGTGCCGTTCGAACAGGAATTCCGCTTAGACGACTCCATTTTCGGCGAGGGTGTGACTGTTTTAGGTGACAAGCTGTTCGCGCTGACATACAAGGcgga
gcaggtgctggtgctgtctcGACATgacttccagctgcttggTCAGTTCCCCCTCACGACATCCACCAAGGAGGGCTGGGGACTCACGACAGACGGAGAG
TTCCTCATCGCCAGCGACGGTTCCGCCAAggtgctcttcttcgacccGCGCGATaacttcaagctgcaccacAGCATCACTGTTCGGAAGGATGGCAAAC
CGGTGACCAAAGTGAACGAACTGGAGTTCGTGGAGGGGGAACTGCTTGCCAACGTGTGGTTTGAGGACCATATTCTGAGAATTGATATCACGACTGGAGA
CGTGTTGGAGCAGATCGACCTGGGCTGGATACCCAACATGGTGGCCAACATCCACACCGAAGCCATGATGAGTTCACCTTTCAAGCAAGATGCCGTGATG
AATGGAATCGCCTACGATCCGGTGACGAGTCATGTATTCTTGACCGGCAAGCTCTGGGACTCCAtgttcgagctcgagttgtCGTATCTTAATTCACATC
GGCGTTCCATCGTCCCGTAGATCGCTGCAACTTCGGCCTTTGTCATCGGTCATCAAACCACCCGTTGACAAGGCACTTGCACCCTCCTGGTAAAAGATAG
ACCAAACTACATGGATTAAAACTACACTTATGCATAAcgatacttcgaagtaaatACTACGGCAACGATCAAAGACAAGTCTACGCCCGCTTTCGTTCAG
CAGGAAAATCGACGTGGGGAGACAAGTACCGGATTACGCGAACTTCTCCGAGTGGAAGTCGAAAATGGTGCCTTCGGCCTTTGAAGACGAGTATTTCTTG
CACATAttggccagcacgtcctcAAGCTCATGGGGTCCGCAACAGAACACTCCGACCTCCTCGCCGCGGTGCTGGGCTCTGGCGTCAGAGAAGATTTTGT
CCCAGTCTGGGCGGCCGAAATGCGTGAGCTGCTTCGTGTCCATTCCAGATACGAAATCCTTTCCTGTCTGTTCGTGTACGAACTCCTGGAACATTTTGAG
CTGCGACGTGTTTTCCTCGCCACCCAGCACTACCGTACTCAGGTACTGGTGGGTCTCAATCACGTTGTCGCGATCCATTTCGGAGATCTGCTTCATCGTA
CCCTCGAACCAGCTCAAGGACTCCTGGCCTCGGGTGACCCAGTGGAAGTACAGCTTCTGGATCTGGAATGAGCTTGGATGACGAACATGGTTGCAGTTCA
GGCAACGGTTGTCCTCCCAGAGATGAACCACGTCCTTCAGGATCGACGCGAATGGGGTGACACCAATGCCACCACCGATGCAAATCACAGTCTTGTAGCG
GTGGTAGTCCTGGGTCGGAGCCCCGACCGGACCATCGAGGTACACAGCGGGATACTGTAGATTGCACGCGTGGCAGTCCGCAATAACACGAGCCATGGCA
TCCGTCCAGTCACCGCACACGCGGATGTGAATACTGATGTAGTTGTCGGCGGGAGCCGACGAAATCGTGAACGGGTGCCATTCGTGAGACGAGACCTGGG
GGCTGTTGATGTACAAGTACATGCCGGGTCTGTAGACGAACCGACGGGGCTTCTCGATGAACAACGCAACAGTGCCGTCCAATTTCATAGCCTCCATGAT
ACGTACTGGTGCAGCGAACATCTTCGCGTAGCGGAAACGACGCTCGATGAGGTAGATCAGGAACGGAGGTGTAATCCAGATGTAGGCTGAGCAGCGAGCA
AGCCACGACGTGGCTCCGTGAAAGGCCAGCACTATGAGGAAGGGTCCAAAGAGCATGTGCGAGTACCAAAAGAGGTTGAACCTGCCCTGCCGGAACTTGG
GGATTGCAGCAAGCGGAAACGAGATGCAGGTGATCACCAGAAGGATCACACCAGTCCAGACTGGAAGAGCCTGTAGCATCGTCGTGAAGGGAGGGCGTTC
GCCGTTCACGAACGTCGAAACGTGGCGAGTGACGAAAATGGAGCGCTTAACTTCGTCCGGGGTGGCGATCAGGTACAGGTAAATCTCGTTGAAAACGTGA
GCGATCGTATGGATGAGACCAGCGGTCAGCAGTACGCTACCCGAGATCTTGTGGAACGCGATGTGATCGTCGAAAGGGATGATACGCCACAAGAACTTGC
TGCGCTTCATCACCTGCGTGATGGAGCGGCACATAGGCAGCAGGACGAAAACGCAGTTAAGCATGGCGACTTGCGCGTTGGCGCGGGCAATACGGAGCCC
CCAACCGATAGCTGGATCGACCTCGTACATGAACCACTTGACCCAGAAGGCGATGTTGTTCACGATGACGTAGAAGAATAGCCACCAAATGCGGAGCTTG
TTGTCGCTGTACCACTGGCCAAACTTGCTCTTGGGACGAATAGGAGCTGAGTACACAGGCTTCGCTTCCTCAAGGTGGTAAGAGTCCGTCACATACGGCT
CGAACACTCCGCAGAACTGCTCGAAAGTCATCGCATCATTATGAACTCGGGCCTTGCGGAACATGAGTTTGGCAACAGTCCTAAACTCCATGCCCACCAC
GTCAATCTTGGCATTTGAGAAGTTCGACTCCAGTAGCTGGACAATCTGCTCCTCAACGACGTAACCGGTGTTCTCAGGGTCCAGCGTGTCAAAAATGAAG
CGCAATTTCTGTTCAGCGTTCACTCCGAGCTTCATCACAGCGTCGATCAAAATGGCATTACCGTCGATCGTGCCGTTGCTGGTGGCATAGCCATCGAAAT
CGTTGCCGTCCACCTCGAAAGCATGCGAAAAGGTTTCGCGCtcgatgtagccatctttGTCGGTGATGTTGCCCATCGCATCacgaagcgcttcaagctg
ctccatgGGCGTGAACGCCTTCTCATCCATGCTCATAGCCACATTGTACTTCTGCTCGGAGTTGCAATCTCCAGGGATCGGCACGGTCACGACGTCACTT
CCGGGAGGTGGGCCGTACATGTCGTCTTTGCCTGCAGGTGGGGCAATACGGCATTTCTTACGGGCAGCGTCGAAGGTTGACGACACACTCGACGCTGACA
ACGTTAAACTTTGACGAACCATGTTCGAACACATCATGGCATCCACATTGGCACGGCGACGTCGTGAGCGACGATTTTTGTTCCTGCAGTTGCCAAGCGC
GTGGGTGGTGGTCGCGTTCATCGAcatgaacttgttgctgtccaTGAAGTTGGTCGTCGCCGGTTTTCGAAGTGGCGGGTTCTGGTGCATGTTGACCATC
GTAGTCATCATTGGGGTAGATTTGTCCCCAAAGCGAGGGGCATTGGGCGATGGTGTAGACATATCAATGAGTGCCTGTGTTTTGGCTGGCGTGATTTTCA
GGTCGTCTTTAGGGTTGCCACGCCTGGGTTCTTTCCGTGAGCGATCCATAGTCGATGGTGAAGTCAATCCTTACCAAattgaagaagttgctaCGGAGAC
GGACTGTGGAAAAGCAAAATGGAGAGTGCGATGCTGAGCTGAAAGCTGGCACTTGAGACCGCCGTCGCACTGGGATTTCCCAGCGGTGTTTGCCGAACGG
TTGAACGCAAGTTCTGTATGTAATTCGGTCAGCTAGAAACGCGCACTACGGCTATCCTCCAAGCAATGCAAACCTTTGGCTCAATAATGGCGACAGGTCT
GCGCTCCGGGAATTCGCTCCTCTACCTGCGTTTTGTAAGGACACGCTCGGCACCTCGAACGATACATATACAGTAGAtagcgccgccgccaatttgcgat
acatgtactggtacatgtaaatgAAGCAGATCACCGGTGCTCATGATGTTGGACGCATAACAACGAAAACCCGCAAAGAGACAGCAACGTCGTGCCTTTT
TCAGGGCCAAAGCACTTCGTGGGCGGTGCTATTCTGGAGCAGACGTACCGCCATCTTTTGGTGGTatggtggcggtggagcaCCCGGCGGCGTGTTAAAC
TTAGCGCCAACCGTGACAGTAACGCTCTTCGGTTTACACGGGCACTCGATGGGGGTAATCGACGAGTTGCAATAGAACCGCAGATATCCTTCCCTACCGC
TGCCAACAAACTCCCGGTCGCTGTCTCGGTGAGCCACAAAACGGAGCTATCCTGGGATGGTCAGGAGTCGCAACGACACCAAATTGCAGGCAAGTTCGCG
CGGCTAATTCCGTACACCCGGGCAACTGCAATACTATTTTCTTCGATAGCGaccggggggggggggggggggggggggggggactgtcgcggcagcagca
ccgcaatTTGCGTTAAACCATAGAAACACGCATGGACCAGGATCAGCATTGGGAGCTTCCTTCGAGCACAGCCGAGGATGGACGTGTAAAGATGTCCGAG
CGCGTTTCTAGTGTCGCTGTCGTTAAGCGTTTTCGACGCGCCCTTGGTAAAGGTGTCTTTTCTCGGGTGACCAGTGCGAGAAACGCAAACGAACATGCCC
TCGGACGTTAATACATGTGCGATACGACCTACAGCTGGAATAAGGTGGCTGACCAGTGTATTTTTGGAACCTTTTCGCACTTGGTGTGATTGAAGCAAAC
TCATGACTGGCGCCGGTCCTTGATTGCTGGCAACGCAAGTCGCAACGAGGACGCCATACATATACACTGTAAACACACGAATCTGTCGAAAGGAATGTGG
TTTGGGGGAAGGTCGCCGTGTGAAGTGGGGATCCAGCTGAACGTCTTGAAGGCGCCGAAAATACAGTTGTCTACTCACGAATCATGAGTCACGATGCAGC
CATTCAAAACGCTGCTGTATCAAATAGTGCCTGCAAATACTGGTTGATCCTACACTTTAATCGCTGTATCGGATAGCGCGTTTAACATCGTGCGTAAAAT
TATCTGGGGGTCTTTTCTTCGAGGGCAGCTTTTCAAAACATACACGCATTTCTTGATCAGAGTATTCAAGCCACCAAATTCTGTTAGCAATGAGGAGGGA
CGATGCGGTTGCAGGTTATCCTTGTTGACCATTTTTCTGAGGAAAACGATAAACACCTTGTTCAAAAACAAGGTCCCAACATGTTAGAattacttgaagt
attaTATTGCAGCTCACGGGTCATGCAACCCGTATGTGCTTACTTTGAAAGGACTGCGGCTCTTTTGTCGGCTTGGCAAGCTTCTATCATGATCGGAAga
tcgagaacgaggagGTAACCAGAATTCATCTCCCGATTGGTGTGGCAGATTGTGATACGCTCGAGTTGGCGTCTCTTGAGAATCGATGTCGCGCCAACCT
CTTAGTGACGCACAGCTATCCGCACAGGATGACAACCCCGGATCGAAATTATCTGCTACCTGTTCGCTACCGCATGCGCAGCTTTGCTCCCCATCTCCCT
CcccctcttcctcctcttcttcttcctcttgaaGTGTCAGTTCATGAATCGTTAGAGCTTGCTCCTCGAGCCGCTTTTTGAGCTTCTGTCGCTCTAACTG
CAAACTCTTGATTTCTCGCAAGAGCTCACTTTCTTTCTTCTCGTTGCCAGTCTGCCAAGACACTCTTTCTTCGCGGAATCTGCTCTTGAGTCGAGCTACT
TCTTCTTGTAATACTTCGCATTCCTGGTGTAGGCTAGCAATCAAGTTAGCGTGCTCGGGCGAGGCGAAATTGTCTGCTGGTCCAGTAAACGACTCTGAGG
CGGTGGGTGAATCAATTCGAGCGCAATTTGGTGGCGACTTCGTTTTCGAAGGGGAAACGTAGGTGCCGTTAGCCTTCGCTTGTAGTAAGTCATCAATTGT
GTGAGCCTGCTCCTGCAGGTGACCAGAATACACATTGAGGTTTCGCCATTCCGTTCCTTGTTCCGTTCAGCATAAACTTACCTCAATCAGCAGGTTGGCA
CTCAACTGCGCCTCTACAATCTCGTTCCAGTGTTTTGACTTTTCCTGCTTTAGCAGCTCGAATTGAGCGACGAACTCCTCGTATCGACGCGTAAGTTGCT
CGTGGTCTTGTGCAATAGATTGCTTATCCGCTTCGAGGATACGAATTTGATCGGTCAAGCTGTCGCGCTGTGCAAAATTCAAAAAGAACTTAGACTCTAG
GTCACATCACCGAAGCTTTTAAAATACAACATACCTCTCCAAGAcgagcaacttcaagttcCTGAAGCTTCTTGCTCTGATCTGCTGTCTGTTCATGCAC
AACGCACAGCTGTTAGTTCTCTTATCTTCTTACGAATGTACTGAGCCAGTTCCTGTCAGACTACTTACCACTGCCGTCAAACTCGTCAGATTTTCTACCA
AGTCTTGCATCGTTTTCTTTGTCCCTTCCATTTGCTGTGCCTCTTCATCTCGCTTTGCAGTCATTTCTCGTACCTTagcttgagcttcttttAGAATACC
CGTCAGTTtttgctctgcttcttgaaATTCCTGGTGCTGAATGTGCAGTGACTTGCATTTGCCTTGCAACACCTCGCATTCTTGGACAGCAGTGTGTAAC
TGTTTGCTTGTGTCTAAATACTTGGAGTTCACTTCTTGGAAACGATCCCAGCGTTCAAGCTCCAGATTCTTCGTGATCTCAAGCCGCGTTTGTTCACGAA
CTGCACCCAACTTAATTTCCTCGTCTAGTTGCTTCTGCTCTGGAGTCTTTAGACACTGAGGGCAGGTTGCGCTGATCTttttgtgcttcttctcaaTTTC
CCAGCATTCCTGTTCCTTAGCCTTCACTGCCTGCTCGTGTCGCACCTTCATTTGCTTCATGGCCTGGTATATCTGCTCGTTTTGTTGTTCGATGCAAGTG
CGTGAACGGAACAAGCCGTTGTAGTCTTCTTGCAGCATCAAGAGTTGCTCTTTAGAGTGCTGGTGGTTGTGCAGCACCTCTCGCCACTTGTCCTTCATGT
GTCTCACCATTAGCGAGTGCTCATCCTTGAGCTCACTTTTCGCGTGCAGCGCCTCTTgcaacgccatcaacaaATCTGCTACCTTTCGTTTATACATTAC
CACCTCACCTcccatcttctccttcaattGAAAACTGGAGCGTTCACGGTAACGTGCATCTTGCAGTTCCTTGTCGACAAGCTGTAGGCGCGTCTTGCAT
TTTTGCAACTCATCCGACATTGGGCGGTGTACATTTTGCCACTCTTTCCGCTCACTCTCCAGCTTGCCTCTTAGCTGATCAACCCTAGCACGCAATGCTT
GGCGTTCCTCTTGTGTAGCACGTACGTTGGAAGCGGCCTCGCTCTTCACCAAGTCTACCGTTTCTTCGTGCTTTTTCTCCAGTgagcgcagcttctcgtt
gagGCGGCTAAGCTTCATTTGGTCCTTCTGTCGCTGGTCAAGTGCCGTCTCAAGCAATGAGCTTGTGTGCGTGAATTGCTCTTGGGATTTCGTACGCCCA
GCTTCTACAGCCGCCATAGCTGTTTGTATTGTAGCGATTTCGCGCTTGAGCTGGATCGTGTgcgcgctcgctgcagccgccgcgtGGGCAGCACTCTGGT
CCTTTTTCACTAACTGCTGCCGCAACGTTTCGAGGTCGCGCAGGAACGAACGACGCTCCTGTATGATTGAACACAGGTCAAGTGTTAGTTCAACGTTGGC
TACATTCGTCTAcatgcaacttcaacataGGGACATATGAGACGAGGCATTTATGACGCTGGTACCTTGTCGAAACATCGCTGTGCATCCTTCAAGGACA
GTGTGGAGGCCGTGACCATGGCTTCCTTCGCCATGTTCAGCGGATGAGGTGGCACTTGGTGCCCTGCAGACACGCAGCACAGTACACTAATCCTGGGCTG
TGGTTTTGGACGAAATTCCCTATCAATATAATCGGTTTTGAAACGGTAAGGGATGTGGTACACCCCATATTTGAAGCGGTATCCGCTGCTTACAAACGAC
AATGGCGTTACGTCTGCTCCAACTGCAGGTGGTCCACCGCCACGGTGACCGCACCCCATTGATCAACATCTTCAAGGAGAGTATCAATGCTCGTtctgag
gaggaggagacgctgctgtgggGTCGTCAGCTACCGGCGCCGACGCAACTCGCGCAACTTCGTGCCAGGTTCAGCGTCCACATGGGCGGCGACGCTCAGA
GTtcgttccagcagcggccATTTGGGTATTTGACGACTCGAGGCATTGAGCAGATGACGAAGCGAGGAGACCGACTGGTGAGATGCAGTTTAGCGTCAAC
AATAATGAACTGAAGACCCATGGACTTGTGTATCGATTGTGCAATGTGACAGCGAGAATTTTGTacggaagaggagctgcGACTGGATGAAGTGACGCCC
GAGCAGGTGCAGATCTTCAGCAACGCATACACACGTACTCAACTCAGTGTGCAGGCACTGCTGGGCGGTTTGCTGCGTGACCAAGCCCATTTGAACCCTC
CAGTGAGCGTGCTCCCGCCGGAAAAAGACATCATCAACAGTGAGTTTGAAGTGGTTTGTCTGGTTTGACGCTATCAAGTTGGCAATTTGACAATGGGCTG
ACTGATGTGGCTTGACACACAACCTTACAGCGTACGGAATTTTTCCAGAGATTATGGGGATGAAGGCGGATTTGGAAAGGGACAACGCTGAATTTGCGGC
ACGCGAGCACGAGATGGCTCCGATCAAGCAAGAGTTGATGAAACTATTTCCAGCTGTAGACTCGGGCCAGATCCCTTTTACCTGGTTAACCGCTGCCGAC
TACTTCGTTTGTCGTCGCGCTCACCAGGCTCCTTTCATCCCTGGCACCGAAGTGCACGGTGATGCCACCGAAAAGCACCTCGGCTTCCGTTTCCACCAGG
TAAGAGATATCCTAGAGAGGTGATTGCTCGTACACGTTGTATCAATCCATTCTGAAGGAGTTCTTTTCTGGCGTCTACAGTTTTACTCTCATCGAACGAT
TTTGAAGCTCGTGGCTGGACGCTTGATGCACAACGTGCTCCGTGAGGTGGGTCAATTCCAGATGTGGAAGTTTTGTTGTTGCGTGCCTGGCTGACTTCCT
TCGTTTGACACTGCAGATGCAAAAAGCTCTGTGGGACCACAGTGAAAGCAAGAAGATTGTGATCTACAGTGGACACGACGTGTCGTTGTTGTCGATCCTC
CGAACCATGGACGCTGAAATTGCAAACGACATCAGGTTTTGGCCCGAGTACTCCTCGGCCCTCGCCCTGGAGCTACTGGAAAACGAGAGCGGAAAGTTCT
TCGTTCGTGCTAGATTTAATGGCGAAATCCTAGCGATGAGCGAGGCTCCAGACGGTCTTTGTCTCCCTGATCGCTTCCGTGATATGGTATCGGATCACAT
TGGGGGCCACACTGATTAGCTTCTTACCACAACAGCTTCTCGAGACTCCCGGCAGATTAGGAAGTTGATAAGCAAGAATAGAAGTTTTGTTACTAGCGCA
AGTTaagccagcagctccgccacttGCAGTGCACGCTTGTAACGTCGCCGAGAAAGCTTGATACTGAGCATTTTTTCcttctcttcagcagctgcttctt
cttcttctttcgtCGGAACACCGATGTCGATGATCTTTTGCGCCAAATCCACCACACGCTGCAGATGAAAAGTAAAAATATAAACTATCGATCAGAAACA
GCAGTTCCTTCAAAAACATCAAACTCCAATTGCTGCTAACCTTGcgtgcagcgccttgaaTACCGTCAAGGTATTCCAGCACAATAGCGAACATGGACTT
GGGCACGACGTCCGCCTCGTACATCCACTGCATAATCCACTGCTGTTTGATTTTCTGCAACGTCACGTATAATCAACACACAATCTCAGAAAATAATGAG
CGACTGATATCCTCATCCTCTGCTGCCCTCCCCGACAACGGGTGGTGAATCAACGAACCTTGAACTTCCacggcagctcgtcgtcggccttGGGCTTGTC
GCGCTTCTGCCACTGCTCCAGATAGTACTTGGCCTGCTGGATCATCTCCGGAGAGCGGTCGGActtgccgccgccttctttAACCTCCTCGGcatccttc
ttcttggccgcacGCGCACGTTTCTTGGGCACAACCTTATCTCCGTTGTCGTCGAACTTGACGTGCGTCGTAgtcgtctccttcttggtcttggtaGCCT
TCAGCTTAccgcgctgcttcttggacGGCTTGGTGGCGGCCATGATGATACAATCGATTGAGCCTCTCAAATTGAGAGTCTTAATGCTCAATTTGAACAG
CTGCCAACCAAATTCCTGCGACGTGTGCGAAACGGCGTGGTGCACATCAATAACGTGATACTCGCTGATTGGCGGAATCTTAGAGTACACATTTCTAATT
GGTGGATATTTCCAGCTCAAACCCCACGGAAACTGTCCGCGCCAAAAAATCGTCAATGAGCATGGTGTAGCAGTTCTCTTCTTGCGAGCGAACGGGCACC
CACAGCAGAGGCCTGTCGCTTGATCTCTTTAGTTGGTGGATGCTCACTGCCAGACTATAGAGTTTCAGTGTCGGGAGAGCGCTCGTCTTGTCGGAATGTG
CATCAATCGCAAGCGACCTCGCACTGGACAGCTACAGAGTCTGCCTTCGacgaaccagcagcttcaagctgacGATGAGCAATTGAAACGCGTTAAGACA
GAGTCTCCGACGTCTGTGGACCGCGTGGGGATTGCAAACAAGCAGGTGCAGGACAGTGAAGAGCTCGCGACGGCAGCGCATcgcgacgagatggtggcgg
CTATCCTGACCATCACGTCCGCGTTGGGACTATCGAGGGAGACGTTGCACTTGTGCGTGGGCCTGCTGGACAGATACTTGGAGCTGCAAAGCATTGAAGC
AGCCAGACTCGAAGCGCTGAGCATATCGTAAGGACTCTAAAAGTTGCAAATGACCGTGGCTGTTTTTTCGAAAGGACAAAAGTGCTGACGTTTCTTATGT
TGCAACTGTAGGTGCTTGTGGATCGCTGTCAAGTTTGTAGAGACGCCTACGACTATTTTCGACAAGAGCATCAAAGAAATTcttcagcgacgaagacact
CGAGCAACGTAAGAATCAAAGCGACTACGGGGGGTAAGACCTAGATACTAACGGTTGAGTTGCTCACGTTGTCTACAGTGGGCGTGGAATGAAATactcg
agttcgagctcaAGATTTTACAGCTGCTTAACTTCCGGATCATGGCGCCCACAATACTTGacatgctgcagaagaaatTCTACGCTATTCAAGAAGAAAA
CAATCAAGAGACCGGAATCGATGGTTTACGGTTCGAGCAGCGCCAACTAGCGCTGTACTTCGCTGacctgctcctgctcaagGCGCGGGCCAACCAGTTT
TCGAAGGTGCTTCTCGTGGATGCTATCTGGTTTGTCATCTCGAGCAACCAAATTTTGGATGTGAAGCCGCCCTTACTGGAACCCGTCGTGCTGCTTTATC
TCGCTCATCGTGACAACATTAATCCAAGTCATGCGGTTTTTAAACCGTGGTTCGCGCTGCGCTGCCGCTATGGCGCCTTCCTACCCTCACCGTGGAAAGT
CCCCTATGACCCGTCTTGCGTATGTCGTGTCTGCGAGCACGTGCAGGTCGAATTGGCGCCATGATGCAAACATCGATCTGTACACTGCCTCGCACAGTAC
AAATGTAATCAGAGCTAATCGTATTTGCGGTACCATCGA