Description :
From Genome Similarity Track
Location :
Scaffold_28:114047- 115700
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12167ATP-binding Cassette (ABC) superfamily

Sequence
1653 bases(100 bases per row)
CAAGAAGACCATCCTGAACAACGTCAGCGGTCGATGCGCACCCGGAGAACTCACGGCCATCATGGGCCCATCCGGATCAGGCAAAACCACGCTCGTTGAT
CTACTGGCCGACCGCATCAGCTCCGGAGAGGTAACAGGCGACATCGAGCTCAACGGTGAGGCCCGCGTGGCCAAGACGTTCCGGGCCGTAACCAGTTACG
TGGCTCAGGAGGACTCGCTGCTCGGTTCCTTCACGGTATTAGAAACCATGCGCATGGCCGCCAAGCTCAGTCTCCCCAACAGCGTCACGTCCAAACAGAT
CGAGACCCGCGTGGACGACGTGGTGGAGGCCATGGGTCTGGCCACGTGCCGCCACACTCTGGTAGGCGACATCTTCCGCAAGGGTCTATCGGGTGGCCAA
AAGCGCCGCCTCAGTATCGCCATCGAGCTGCTGTCGAACCCGAGCATCCTGATCCTGGACGAGCCCACGAGTGGCCTGGATTCCAGCGCCACGCACAACG
TCATGAAGTTCATTGTGAAGCTGTGCGCCGAGGGCAAAACCATCGTGTGCACGATCCACCAGCCGTCGTCGCTGGTGTACGACATGTTCACGAACGTGGT
GGTGCTGTCGGCCGGCCAGACCGTGTACTGCGGTCCCCGTCGTCTGATGATCCCGCACTTCGCGTCGGCCGGTCACGACTGCCCCACGTATATGAACCCG
GCCGAGTACTTTATCAGTCTGGTGAACACGGACTTCGAGGACCACGCGGACGTGCCCAAACTGGTGCAGTCGTACGCACAGAGCGAGATCCGTAAGGAGC
TGAGCAACCGCATCGAGAGCGACCGCAAGACGCTGCAGCATCTGCCGGATATCGAGCAGCCGTCGCCATCGTCGCTGCGCCAATTCAGTGTGCTCATGTA
CCGCAACACGCTCAACAACATCCGCAACCCGGGGATCTACTGGATCCGGTTGTTCATGTACTTCTGCTTGAGCTTCATGGTTGGCACAATGTACCTGAGC
ACGAACGACGACTTGACGGAGGAGGACCTGGTGCCTCTACTGTTCTACGTCCAGGCGTTCCTGGTGTTCATGTCTGTGGCCGTACTGCCGTTCTTCATTG
AACAGCGTGCAGTGTTTGCTCGTGAACGTGCCAACAGTTCATTGAGTGTGGTGAGTTACGTGTGTGCCAACTTCTTGGCTACACTACCGGGTATCTTCCT
TATCGCAGCGATGTCGACGGCTCTGGTGGTGCTTCTAGCGGGTCTGAACGCCATCGAATATTTCCTATTGAACCTGTTCCTGTCACTGGTAGTGGCCGAG
TCGATGATGCACGTGATCGGAGCCGCCGTACCGCACTACATCATCGGTATCGCATTGGGTGCCGGTGTGTTCGGCATGTTCATGCTATGCGAGGGTTTCA
TGGTTCCTCGAGACTCGATCCCGGACTACTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCATTTGTGTTCAAGCAATTTGAGAA
TGAGACGTCGGATGCAGCCAAAGCCATTCTGACGAAATATGGCATGGAGGACGTGAATGTTTCCCAAGATATGGTGGTGTTGATCGTGTACATTGTGGCT
TTCCAGGCCATATTTGCGTTCATCCTGTGGAAATTCCACACAGGTCGCCGTTA