Description :
From Genome Similarity Track
Location :
Scaffold_19:114042- 116768
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05392myosinlike protein putative

Sequence
2726 bases(100 bases per row)
TACGCGCCAAGCCTCGTCGAAGCCCTTTGACAAGGAAGGCGCGCGCCGGCGGTTCCTCCAGAACCAGCTGCGGCTTAAAGCCGAGGCCAAGCACAGTGTC
GGCAAACACCAAAAGACGGCCAACGTCTGCGCACCCGGCATGCTCTGCTACGTGCCCGACGAGACGGACACGTGGCTGCTCGCCGAGGTCGAGTCGGTCG
ACACGCGTCGGAAGCACGTCAAGGTCAAGCTCATCGAGGGCGCCGCCGAAGCGCGCGTCGTCGACCTCACCAACATGGACGTTGTCCGGGCGATCGGCGG
GCCGCAAGCGACCGAGATCGACTCGCTGCCGTTGGCGATCACACACAGCAACAGCGACGGCGTCGAGGACATGCGCAACCTCCGTTTTCTCAACGAGCCG
TCCATCATGTACAACCTCAAGCGCCGCTTCGAGGCCGCCCAGCCCTGTACTTTATTTCGTTTTCTTGGCGATTAGATGGATGTTGACGGGCGGTGTGTTT
AGATACGTACAGCAATGACATTGTGATTGCCGTCAATCCGTACCAATGGCTCGGACACCTCTACGGCGAGGGCCTCCACGCACAGTACCTCCAGCAGCCG
CGGCACAACCTGCCGCCCCACGTGTACGCGACGTCGACGGCCGCGTACAAGAGCATGACGGCGACGCGTCGCAACCAGAGCATCCTCGTGAGTGGCGAGT
CGGGGGCCGGCAAGACCGAGACGACCAAGATCCTCATGAACCACCTCGCGACGGTCGCCGGCGGCCGCGACGACTCGACGATCGCGCGCGTCATCAACGT
CAACCCGCTCTTGGAGTCGTTTGGCAACGCCAAGACGCTCCGGAACGACAACTCGAGTCGCTTTGGCAAGTTTACGCAGCTCCAGTTTCGCGACGGCAAG
CTCCGTGGCGCGTGCTGCGAGACGTATTTGCTGGAAAAGTCGCGGGTCGTGTCGTTTGCGCCGGGCGAGCGCAACTACCACATCTTTTACCAGCTCCTCT
CGGGTCTCCCGGCGACAACGACCGCGTCGCTGCAGCTCCATGCAACCGCGAGCTTCCGGTACACGGGCGATGTGGCCGCCATGACGATTGACGGCATTGA
CGACGCCAAGTGGATGGCGCAGACGCAGCTGTCGCTTGGTCTCATCGACCTCGATGCGCGCTTCCAGCAGTGCGTTCTTATTCTTGTCGATTGGACGAGC
TGATTGGGATCTATGATCGTAGGACGCTCTTTGAGGTGCTCGCCGGGATCCTGCACCTCGGCAACCTCGATTTCGCGCCAACGGGCGAGAACGCGTCGCG
CGTCGCCAACCCCGAGTCGCTCTCGGCCGTCGCGTCGCTCTTGGGCCTCGCGCAAGACACGATCGCGACCGCGTGCTGCAACCGCACGGTCGTTGCGCAC
CGGGACGCCGTCGTTGTCCCTTTAAACGTCGTCGAGGCGGCCGAGAACCGCGACGCGCTCGCGAAAGCCATTTACGCGAGCCTCTTCGATTGGCTCGTAT
CGCGGATCAACGGCGCCATGTCGATCGACGACGCGTCGACGCAGATCGGCGTCCTCGACATTTTCGGGTTCGAAGACTTTGCGCACAACGGGTTTGAGCA
GTTTTGCATCAACTACGCCAACGAGAAGCTGCAGCAAAAGTTTGTGCAAGACGTCTTCTCGACGGTCCAGGACGAGTACACGCGCGAGGGGCTCGTGTGG
GACCACATCTCGTATGCGGACAACCAAGGCATTCTGGACCTCATCGAAGGCAAGCTCGGCATCATCAACCTCATGAACGACCATTTGCGCCAACCCCGGG
GCACGGAAGAGGCGCTCGTCAACAAGTTTCGCACGAAAGACAACACGATCATCTCGTTTGCCAAGGTCAAGCGCACGCAGTTTACGATCCGCCACTACGC
CGGCGCGGTCACGTACGAGACGGTCGGCTTTATGGAGAAGCACCGCGACGCGCTCCTGCAAGATTTGCTCGACCTCGTCCGGTCGAGTACAAAAGCCTTT
GTCGTGTCGCTCTTCCCGCTCGAGGTGGCGCCGCCGCCGACCAGCGACGAGCCGGACGCGCTCGCGTCGACGCCGTCGCCCAAGTCGAAGCTCGAGGCGT
GGGTCAAGAAGCCCGAGCCAAAGCCTCTGTTGGAAGGGCGCAAGAAGGCGCTGCCACCCAAGACGCTCGGGTCGCAGTTCAAAGCGTCCCTGAGCTCGCT
CATGGACACGATCGGCTGTACGCAGGTCCACTACGTGCGCTGCATCAAGCCCAACGCGGTCAAGAGCCCGAGTGTGTTTGACAAGCCGATGGTCGTCGCG
CAGCTCCGGTCGGCCGGCGTCATTGACGCGATCCGCATCTCGCGCGCCGGGTATCCATCGCGGCTCACGGCGCACGAGCTCGCGACGCGGTACGCGACCA
TGCTGCCGCCGTCGATGCTCACGGGGCAGGACGACGCGTGCGACGCGTTCATGCGGGCGACGGGCCACTCGTCGCCCGTCGAGTTTCAAATGGGCAAGAA
CCTCGTCTACTTCAAGGCGGGCGTCCTCGAAGAGCTCGAGCTCATGAAGTCGGACTTTTACTACGAGCAAGCGACGCTTGCGCAAAAGGTCGTGCTCGGC
TTCCTCGACCGCATGCGGTTCCGCAAGACGATGGCCGCCGTGCTCTCGCTCCAAGCCTTTGGCCGCATGCTGCTCGAGCGCTGCGTGTTTACAAAGCTCA
GGGCCGCCGCCGTTAAGATGCAGCGT