Description :
From Genome Similarity Track
Location :
Scaffold_40:1140350- 1141386
Sequence
1036 bases(100 bases per row)
AAAACCAGAAGTGATTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCAT
AACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCGCCGGGTACTTCGTACCCCTGTGTG
TTCCACACCATGTAACCCCGTTACAAGAAGTGTACACTTGTACACTTCGGACGCAACGCGACAGAGAGCGACGACCCTATCAGTGTCGCGCATGTCCCGC
AAGTTGCATTCGATCCCACCGTTGGAGCAGCACCTTACGCTGCCGCCTCCTTTGCCCATTCAAAAGTCGCAACGTCTAAGGCAGTCGTTGAGTCAGTCTC
AAATCGGATTGAGACACGTTCTTACTTCAATGACCGTATCAAATTTGGGAGTTGATCGACCAAATATGGTAGAACTTCAAATCACAGACAGTGACTGTGT
CGGTGGTGCGTCAGTCCCAGCAACTGACACATCACCTAGAAACGGTAGCTGCGATGTCGGCGTGTCAGCTCCGGGAGTTGACACGGTCGTGAATGGTTCA
AAAATCGCGAAGGGCTCCGACGAAAGGCGTCGAGGTGACAAGGACATGTCGACTCCGGTAGTCGACACAAACTCGATTTCAACATCGAGAGGGGACTCCG
CCGAAAGGCGTCGAGGTGATGACAGCGCGTCAGCCCCGGGAACTGCCGACGCGGCAAGTAGTGTTGTAGACTGCAAACGTCCAACACTGAAAACGCTTGC
GTGCTCGCGTGCAGCCGGACTGAACGACGAAGCGGAATGTAATCGAGCCGGGCTTGATCATTCGCGTCCGCGGAAAGAATCCGCCGACGATTACAAGGGA
AATCCGTTTAAGACCGGGCCTGGACGAGGAACATGTGAAGCCGGGCTAATGCAACTAGGCACGTTATTTTGAACATGCACGTCGCTCACTGACTACCACG
CTCACATAGCCCCGCTGGGAGCCGAAGATGCAGACT