Description :
From Genome Similarity Track
Location :
scaffold_673:11402- 14432
Transcript NameFunction/comments
g9805.t1hypothetical protein

Sequence
3030 bases(100 bases per row)
TCGCTGGAACGGCGCAAACGACGTTTCCGGCGAAGCAGGTCAACGCACTTCTTCTTCTCTTCGGCGGTGAGCTTGTGGGCGGGAGCCTTCCCCGCTGGCG
CAACCATCGCTTCTCGTCAAGCAGGAAAATCGTCAAATGACCGGCGGTGAGCGCCACGCGGCCATCCATTGGAGAATGTTCTGTTTTTGTCACTTTTAGT
GTTCTCCCCCATCCCTCATATACTGTGGTTCTTGCCTACCCCTGTGCATGGTCTCATCTTTTACACGAAAAAATAACTTGATTTGTGTATTGAGAACTTT
TCAATACAAACAGCAAGGCTAAAATGGAATATGTTGGTGGCTCCAACCTGGGTAAAAACGCTGCGGTTAGGTGTTTAAGAGCTATTCACCCGTTATGTTG
GTGGCTAAGGGGTTAAATTCGTTGCGCAACCTTACCATGATTCTTCGTACCTGGCATCTTCTTCTTCGTCTTGTTTTTCTGGTGTACTTTGGCCGCTGTA
CAGATAAACTTAGTAAGTGAAATACGATGTGACATGTTTCCTGCTTCCGCTAAGTCCACGGCATGTTCTTGCTCTTCTTCATCGACCAGATCATCTTCCC
CTGTATCCTCCTCTTCCATTGGGACGAAATCTTCATCAGTGGGGTGGTCTTTCTCGATGCCTAGCGTCAGATACATGTGGTGTGGCCCTCCGTCGGTGTT
TTTACTGCTTCGTAGACGTCGCTCTTCACATGAACACCAGATATTTGAAATTATCCCCCCCCACGCCGTTCTCTTCTGGTACCTTACCTCACATGATGCC
CCTCCCCTCTTGCACACCACAGCGTGTGTAGTTGTGACGTTCTGTGGACTGCGGTTACCTGCTCCGAGAGAGCTGCTTTCGCCTACCGGTAGGGATGCCT
CTGCTGCGCTAGCACACTTTTTCGATTTGGAAATGGGGGCAAAACGCAGGAGAGAAGAGCGACAGTCTTTGCTAGAGCACCTGGACCATGACTTCCAAAC
GTACATCTACTCCTTCAAAAGGCTTCGAGGCGGCAAATTTCCTCGTTATACCGCTTTGGAGAGAGGCGGGGGCTTTGAGTGATCGTACTTATATCAACAT
TAATAGTAGTGTGAACTTAACTGATAGGTGAGCACCTAAGAGACCATGAAATTTTTGAAGGAAGTGGCTTTCTTGCCCGACTGCGTGTGCAAGCTTACAT
TTTTTCGCCAGCACTTCACGATGCTTTTAGGAAACGTTTGGTGGCTCCCATACCTGTACGTAGAACAACACTGCACGAACTGCACCGCCCTCCAACCGTA
CAACGATAGTATGGCGGGCAAGGGAGTACGATTCAGGTGTTTGTTGGGTCCGGGTTATGCACAAACAACGAGAAAACGACGCCTTTACACGCCTTTGTTT
AGGGCCTTAAAACCCTAAATACGGAGTGTAAAAGGCTCCCAGTCGGGCAAAATAGCAAGTGCCATTTCTGAAACGGCAAATATCGAGCCCATGTTTTCAA
AACATGAATATCCCAGATACTTATCCATAAACTTACCATGTTCTAAAATAATTTACGCAGCGGTGAAAATTACGATTTATGACTATTTTCTACTCAACGC
CCTGTCGTTACGCGAATCAATGGGATCTGTTCAAACTGTATCATTTCGGATTTCGCAGCCCCCTTTTGGTTGGCACACATTTGTCGCCATACGCGCCAAC
GGCAGAGTCTCGAGCCGTCGGAACGCCAGCCGCTCCCCCAGCCGCCGAAGCAACAAGCAAGCCCTTCCTGCTGCCTCTCGTGATCACTGCGTAAGCACGT
ATGCGTTTGTTGTTGTTGTGGCTGATCTGCGGTCTTTTCTGTTGGTCTAACTGTTTATTTGTCAATTTGAAACAGTTCTTGGTGCTTCCAATTGCAGCGA
TACCGGGTGACGAGTTGGAGACCTAGCTATGTTTGCTGGTTGGAACAAGGTACGTTGTCCATTAACCTTTGAGCCGTGACAACAATTTCGAAACCCGGCT
ACTTACTCATGTTTATCCATGTTTTATCCATGTTTAGAACGAAAATCATGGCTCGCACTCATAAAACGACGGTTATTATGAAGGGCTTCCATGCACAACA
AGAAAAGAAAGCTGCTGAGGCGTCAAACAGTCGTAACGAAGAAAGGAACGAGAGGGTAGAAGATGGTAAGAGAGCTGCAGAAGACGCAGAAGACGAAGAA
GAAGAGGAGGATCAAGAGGAGAAAGCAGAAGCGGAGGAAGAAGAAGAGAGGTGTGCACCTGAAGAACATGGCGCTGCAGATGAGGGAAACTGGACGTCTG
GAAGTGAGAAGCGCAAGCGCTCTTCATCTGACCAAGACACGGATTTGCATTACACACCAGCGCTTAAGAGTTCCCATAAGTCCTGGGAGGCGTTTGAAAA
GTACTTGACGAAGTATTCCCGCCTTAAAAGCGCCAAGATGGTTGTCAGCGAGACGCTCAATGTTGCGCTGCGAAACCGGAAGCTTAGGTCACAAAAGCAG
TACAAAGGCACGAGCTTTCACTGGTACCAGAGGAAATGGACCCGTTTCAGCGCGTGTACATTTGTACCCATGGACAGAAGCAACGTTCACGATCAAAAGG
AAAGCGTCCTACGCAGCGTACATTCTACACGGGGTGCTCTGCGCGATTTCTCGCTCAAGTCGTCGAGCGTGAGGAAGGTGTTTGGGACATTGAAATAAAG
CGGGAGAGCTTATGGACATAATCATCAGGTTTCTGAAGAAATTTATCGGGCTCATCCAGGTATTTGCCAGGTTCCGATGTTGTCTCCACTGATACGAGAC
GTGGCGCTGATGGTGGACTGTGGTGGAAAGGCAACGCGGATTTACGACTACATTCGAAACAATTCTTCGCACCTGGTGACCATGGCCGACAATTTGATAC
GCAGAATCAAGAAGGCCGGTGCGTGTGTATTGTTGTGCAAGTGTATCAGATAAAGTTCACTAATATTTGACTTGTGGGCTCTTTCCCTCCGTTCAGGGCA
CGATATGTCGGATGAAGATTAAGTGGCGGA