Description :
From Genome Similarity Track
Location :
Scaffold_3478:1140- 2534
Sequence
1394 bases(100 bases per row)
CGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGATGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGG
GCCTCTTCGACAGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACCCTCCCAGACGTACG
CGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGCATGGCGCCGGGGCTCGTTTGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGC
CGTCCCGACCGAGGCTTAAGTGTCTGCTCCGACGACCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGAGCCTGCGAGTCAGT
AACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAGGTCGATGGTGTACGACGCACCATGTC
TGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCTAGCGGTAGGTTCCTCGTGTCTAATAGCAC
TAAGTCCCCCACTTTAAATACACTTAAGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTCTATCCTGGGCCGCTGCCATGGCATCGCGGACCCTG
CTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCT
CTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGA
CGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGGAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGC
ACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACG
CAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTGTTTCGCCCGT
CACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCGGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAG
ATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTAACCCGCTGACA