Description :
From Genome Similarity Track
Location :
Scaffold_2945:1140- 2384
Sequence
1244 bases(100 bases per row)
CCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATTTTCTGACGTAACC
GATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGCCAGGCC
ATCCCCGAGATCCTCGGCTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACC
CTCTTTCACCTGTCATCCCTTCTGTCTTCGTGGGATCAGGTACCCTGGTACCGGGGAAGCCACCAGTTGGACCGACTTGATCCTCTAGCGAGTATAAACA
CGACGGTTCTTGTTGGACTAGTGTTGCCACTCTCGACAAGGATCCAGGCACTTTGTCCCATGAAATACTAGGATCCATTCGGGGGTTAGCAGGATCTGGC
GACCCGGCTTCAGCCCTCTGCGATCCTTCATCCACTGACCCTGCGTTATCTAGGGGCCGGCTCTGGAGATCATCCCCGGTCTTGGATCCAACCTCTATCG
CTTAGATCTCAATCCGACGATCTCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCCC
CTCCCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGG
ATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATTATGTAGTCTCTTATCGCTGAAGTTCGTGACCTGGCGGTATTGTGATCGACCTGGTCCTTGGG
TTACTGTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCCTGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTCTCTCCGGGCTCGAT
CCAGGTCGTCTTATCTGCCCGTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACAAAGTGTC
CCATCCGCCAGATCCAACCTCACTCCAGCTAATACCATGAAATTCATCCCGAGGATGGCGTCTTGACCAACGAGCTCTCCAACCCAAATATCTAACCAGT
ACACCAAACAACCTGCCAGCGTGATCTTGATCCGCATTCTTCCA