Description :
From Genome Similarity Track
Location :
Scaffold_1253:1140- 2189
Sequence
1049 bases(100 bases per row)
AAAAGCGGCATGATCAGCTCTTGCACTAAGGCCTGGAACGCGTAGAAGAAGTTCAGTGGATGTAGTAGGCGTCGTGTTAGGAGGCATATAGCGCTGTTAG
TGTTGTTCAGTATCGATCTAGGCGAGCCcTTCCCAGACTCCATgAAGGCATTAGCCTTCACAGATTAAATAAAGTTGTGAACGCAGATCAGCAGCGTGTG
ACGGTGTGTCTCCTTGGCATAGTCACATCTGGCTTTAGTTCGTGCGCACGCTCCTCCACCATGAGTAGCTAGAAGGTCATGACAGCAGTCATTCACCTCG
GCTGCATCGATGGTAGCTGTGTACCAGCGGCCAAATGTGCATGACCGAATTGATAATGTTGCCATCTCTTCAAAGCCCACAATCAGTTGGCCAGCACAGC
TACCTTGCTGCTCAGGCGCTAAGCTCCGAACATCCCGCGACCGTCGAGCTCTCAGGCGACGGCTCGGAACACCCAGCAACTTTGCATATGCTCCTCTCAG
ATACGCGGCCATGGCTGCCCACGACATCCGGCCGCGTCTAGACGGTAAGGAGCTTTTCATTTTCTAGCTATTGGAATTCGCTATCGTTTAACTCAATAGA
TTTCACCTTATCATCATCATCTTAACGGCGTGGGTACGCTAGGCCCAGCCTCCGACGTAATGGTGGTCAATGACAGTTCTCTGATCATCTGATACACACA
CATGCATCACCTCTGATCGCCTCGAAACGCCACCCTGCTACGCCAGAATATAGGGGACAGACGACTCGTATGCTACTTGAACCAAGCACAATATGTGTGC
AGCGAGTATTGTCGCCACCGTGAATGACGGCCAGAGAAGTGGGAGGGCGGAAGTCTCGCGGTTACACTCAGTGTGTCCGACTGTAACCcTGTATCATAaC
CGACTCATACCCCCcAGATGGgTGTCATTtCCTGTGTCATTTTtATAGCATACTCTCACAGTATCGTGATTCTGTGCATTTCAcTTCCCTGTTCAGTTCA
TTGGATATCCTGAGAATTTGCAGATTCTTGGGCAGTTGtCTTTGCTGGC