Description :
From Genome Similarity Track
Location :
Scaffold_1584:114- 2539
Sequence
2425 bases(100 bases per row)
CCGCTCAGCCCCCTGGGCGCCCGGATCTTCGCCGGACGATCTCCCCTGCCTGGGCAGAAGCCAAAGCACCATGCGTCTCCAATCCCCCGTAGGGCGAGAT
TAACAGCTCCCCGATTTCGACTGACGAAGGCTCCGACGCGATCTGCTCAGCCCCGCCAGGCACGATCTTCCGCCCCGCTCAGCCCCAAACCTGAGCGTCC
AACGCGCGGTTCGAAGCTGCCTCCACCTCGCCCTGAACGTACAGGGCGTACGCCGTATCATCGTGAAGGCCCACCACCCGATAATTGACTCGGTGGGTGA
CGCGCGCTGGATTGTGGAGCGTATCGTTGACCATGAAGATCCCCACAGCTCGACCGCTCAACGAAACGTCCGTAGTCGTGCTCCTCGCGCGGTTCCGACC
GCGCGCCGCTACTTGGTACGTTGGCTCGGTTATCCCCCAGAACATGATACGTGGGAGTCCCGCGCCAACCTTCTCCGCGACGTTCCGGACGTGGTCCACG
AGTATGAGACCATGCTACTTGAGAAGAAGAATTCCGCGAGTCACCCCGCGGAGACCGTGAACGAGATCGAGAACGGCCACGAGAACGACCCGCACGAGGA
GGCGACAACGACGCCGCGCTCCGACGCGTGTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACA
ATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATG
GATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATA
CAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGC
GAGGTACCCCGGATCCCATACTCCTGAGTTCGTATCCAAGGAGGGAGGATCCCGCCTTGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGG
ATCTCGAACTTTCGTAGGACAACGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGA
GGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATATGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGG
GATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTA
AATATCAATACAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGG
AATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTA
ACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGC
AAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGG
ACGCAGAGTGAAGATTTTCCACTGCTGCTCCACTCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCTCTTGAACTCTTCGGAAGTTACCGAGAGA
GCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTT
GGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATAGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAG
TCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAGGACGCTGCTGAATGAAACAAGATTCGCGGATC
GATGGAGTTTTGGGAGGAATTCTGTCGACGGAAGAGAGGTGGATCCGGATCGGGATCTAGGAGAGAACCCTCTCTATCCTCCCCAGGTCCCCTCGGGGAC
CCCTGCGGGTCTTGACTTGCGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGCATTTTGCAGATTCACCGGTTAAGCCAACACCGTAC
CTAAACCCAACCCCGCTAGTCGAAG