Description :
From Genome Similarity Track
Location :
Scaffold_4319:114- 1245
Sequence
1131 bases(100 bases per row)
CCGGAGGTAACCACTGACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAA
ATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGA
TCGCTCAAAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTC
CCCGTGGGCATCCCCAGTGGTAATCATCAGCAAGAAGAACGGGGTGGATAGACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATG
GTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTA
TGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGTCGTTTGGATTGAAGAACGCACCCCAGATCTA
CCAACGTATAATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGAGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAG
GCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCG
AAAGAGTGACATCCCTACTGGATGCGTGTACTAAGTGCAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGAATGCGCAAGGTGGATTACTTAGGCCA
TCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTTTTCGTTAGCCGATTTGTCCTTGACGCAGTCGTTACCGCCGATCCAACCTTCATTG
GGCAGTTTGAACTACCACAGTCGGTTCATCGAGGATTCCGGCCTGTTCGACGCGTTGAAGTATGAAAGAGAGAGGTCATTCCGGGGCTCGGACCCCTCCA
GCTGTCCGGATAAAAAGCCAACAAGCTCTGC