Description :
From Genome Similarity Track
Location :
Scaffold_21:113999- 116872
Sequence
2873 bases(100 bases per row)
AATTGCTCGTCACTCCTGTCGGAGAATGCCGGCCTTCACATGAGAATCTGGGTCTATTCCGTTTTGTCAGCTCGTTTTTTGGTGAAGTATTACTTTAATT
ATGGATCTTATCGTTAACCCACAGTTTACTTAGGCAAAATAGTCCATTTTTTGCTTTATCTAGACTTTAGTGAAAATAAAGCTAAGTCATGGTAATTTAC
TTTTAAACGCGGCAGGCAAGAGACAGCTGTCGCTAAAATGACGATGTGATTGGCCATATGTTTTACAGTACAGCATTTTAGCCTAGGATGATAATAGTAG
TCGAGAATCGGAAGATAATAGCTGGTATTAAAGTGACGGAAACATTATTATAAGGAAGGTACAACCACCAGCACTTCTACTTTTTACGGCATTATTTTCA
CTGCAAAGTCGATGCTGGATGCGGTCTGCCGCAATCCCGAGATTGGAAGCGACACTCAAAAGAGGTGGTCTATAGATGTAAATAAGAATGTTTAATGTGA
GACATGACCGTCCATGTTACCCAGACTTGCCGACTTACGGAGTGGGTACTGTGATCCGCGAGATTCTTCATATCTTGCGCCCGTCCTCTGTACCCTCCGC
TTTGAATGAGCTGAAATCTTTAGTGGTGTTGTTGGATGTTTTGCCTAGCCAGGGGATTATATTCAGCCTTGGATACTGCACGGGGATATTCACGGGAATC
TTCACGCAACGCCCCTAATAAACTTAGGATCTTTCAGCAGACCGCCAGTCTTATCTTAAAAACACTCTTGATTTAGATAGCAATTTTATAAGCAATTTCC
TAATCCTTAATAACACTCTTGTTTAGGCTTGTCAATACTTGATCGTACTTGATCCTGACTTGTAAAAGGTTCAACGATCCACTAACCAGTGGGGTAGTGT
CTCAATTTTGCCCGCCTTTCCTTTTGATATTTTTCAGCGAACAATCGCTATCGATGTAGTACATTGAGAGTTCTCAGATAATTATCGCCAAGTTGTCCAG
ATGTCTTAGTTGTATCATGGAATGTTTACCTTCACTCGCCAAGAAAGAGGGGGTACAGTGTGCCATGCCTGGAAAAGATGGCTACGTGTGGTGTGTATAA
GAAACAAAACAATTTAAGCCTGTGTCATAGTGTACTGGTGTTACGCGTCGCTTTGTAAAACCTTCAACTAATTAACAAGAGAACAGCAGCGCATTAACAT
TAATAGGTGGATAATCAATTTTAATTTGTGTACTACCCCGGAAGTTCATATCAAGAGAGTATTTCTCAGCAGCTGAAGTTTTTTAGCTGGAACCTTACAC
TAGATAAGGTGTATTCACAAATTATACCGTAAATAAATGGTTACATACGTTCTTGTACTCATGACTCTATAATACGTACGAGTTTTTCACTACTGTTCGA
TTACGTTATGCGCAATTACCTTTGTACACAGGATCATGCAAGATCGAGTTCTTATTGTCCAACGAGACGACAAGGAAGTGGAGGCCAATGGAACTCTGCT
ATGTTCAGAGCGAGAAATCTCGCACCCCTACTCCCAAATATAAGAAATTGTAGACATGCATGTCAAAAGACAGGAGACTAAGCATATGAGTATAGTTTCC
CGCGTCCAGTGTCTCAAAACACTCGATGCAACGATCGCCTCCTGACAAAAAGGTACAGATACGTGGGTCCAACGTGATCGCTAAGACGTAGTAACGGAAT
GGACAGTCAAGAAAAGGTCGGTATCAGTAGATTATGAGTAACGTGCCAATTCATTAACGTCAAGTGAAATATAAGGCCTCTTGAAGAAAATTACAACCAA
CACACAATCGTCGTGTGTTGCTGCTCCTGGTAACGATGTTTTCTTGATCACCTTGGAGATCGACTTGACAAAGGATATGTTGCCAATTCAATCCTTAGTC
GACTGTAAAGCGTCTAACAACTTTGTACTAAGCCAGTCTCTAGAGTATAGTAGGCTCAAGTTCGTTGAGCGCGACACCCTCCAAAGAAAATGATGGTACT
CCTTACAACAGGTGCATACGTGCTGTGGCGTGTAGTGGAAATTTGCTACACGCTAAAGAAGATGTACAATCTGACGATTTTATGCCATCGTATTGGACTC
GGCTGTAAATTGGTCATCCTTGGTTTACCATGTCTCAGAAGGTAAGAAACACAAGTCATTTGGTAGTGTTAAAGAGTGGAGACGACTGTCGCTTGTTCAT
CAGGTGTCCATATATTGAAGGTCTTGCATCTTCCATAAGAGTGCGGATGTACTACGAGTGAGTGTGATGGTCTCATATTTGGTTCAGTAGTTAATACCAC
TGCACAAGAACCCAGTGCGTTACGTTACCACACCGTAAAGCAAGATGCCGGAGGCTCTGTGGAATCCCATGCAGCGCCGAAATCACACCCTATTCAAATA
ATCGGGTGGAACGGGGCATGGATGTTCCCCTAAATAGCAGCATCCAAGTACGACAAGATCGATTGACTTCGACATGACCTGGGGCAACACTGCGATAACA
TTTGGGTTAGTGAAAGATAACCTTACACTCGTTCTCACCGTGTTTCACAACCGGTTGTGGACTTTTAACGCACAACATGTGGAAAACCAAGCGCCAAAGA
AGAAAATGGCAACGCAAAAACAAATACTCATCAATTTTGCCGTTTCGGACGATGTCGCGAATATCAATGTTTAGCATTAGAGTTTGGGTCACACTAGATC
GCAGTACATTCTATTGATGGTGAGCCGGGGCATTGCCAAAGGGATTATGCTCGAGCGTCGAGGAAGATGGATTGTGAGGATTATCCCTTTGCTAAACAGC
GCAGATGAAAGACCAGGTACGTACCTGGGGGTGGAGGTTGAGCAAAATATATGGACATTATCAAGACTCATCA