Description :
From Genome Similarity Track
Location :
Scaffold_72:113984- 115583
Transcript NameFunction/comments
Hyaar_Emoy2807987vacuolar protein sorting-associated protein, putative

Sequence
1599 bases(100 bases per row)
TTTGTGCCTGGAAAAAAGGTGTTACCTCCTTTGCTAGGACGTTCATCACCACATTCGTCAGAACTAGACGCACCATCTTCGCAGTTCAGTGGAAGGTTGA
CAAGCAAAATCGTCAATGTAGACGGATCTGCTGTTCGAATAAGCTCACTAGATCTGGATGTATCTTGCGTTCGCCTAATGTTTCTACCACAGACTCTTCT
CCAAGTAGAGCAATGTGTCCTTGATGTGTATCTGGCGGCAAGTATGAAGGCGATTGAACTGGAGCTTCAGCGGGGTAAGGCAATGGTCACCGAATCTCCT
CGAGTTAAGGACTCTCCTTTTGTTGATACAGGTATTAGTCTCGACAACAGTCCGGTTCCCTCTTTTCGACCACGAAACAACAGCATTTCCGAGCTACTCA
ACGATACTCGTAATGCAGTTCGACCAGAATTCGCGTCTCCGTTACAGCGTATGCTGGGCTCAACCGGTGCTATAGAGAGTCGGACTACTGGAAGCTTTAC
GTCTCGTGCGATTGTTGAAGAGACTGGAAGCGGAAAGTCGGTGGCCGATGGTCCTACAAATACCAGCATTATCGGTGTTGCGAGAAAACTGCTTATGATG
CCCCGATGGAAGGTTGACGTCCGTTTTTCGAATTTGCAAATGTGGTTGGTACCGTCTGATCGCAAGAGCGACATGGCGGGTTGCGTGTTGTCTAGTCAAG
TTGTCGCGAAATTTGATAGTTCCTGTGGTGGATTTGAAGAATCTACTACTTCTCCTTGCAGTGATTCTGTAACTGCATGGGCTCGACTGAGTAGTGTGGA
AGTTTCGACGGGCCCGCCGACCGTCATCGGTGCTGAACGACAAATGACAATGAAGCATACGCGAACGCTTGTTGAGAAGTTCGAAGTAGACGTCCAATTT
GCGCTGCGCCAGTGGTTTCGATCTGCGCAGGAAGACAGAAATGTTAATCCTGAAGGCACTGATAAATTGAGTGACGGCAACAGTGATTTGAGTATGACTG
GAGAGGACAATGTCAAGAACAACGACGAAAAAGCCAAACTCAGGCCATGGTTTAATAGTCATCCTAGTAGGATGGACGACAACCCGACATCTTTGCCCAA
ACTCTTTCTTCGCGATGTGCCACCCGAGTGGCAGGAATGGATTCTCAGTAGACCATCGGTTTGCATTAATCAAATCGTGTCGCACATTGCTTACCGAGAC
TTGCCGCTGTTGTTAAAAATTGCTGCGAGTCTGACTAGCATGCTTACTATTGAGGCACGGATTCGCGATACGTTTACTGCAAGGCTAAGAGCAGCAACAG
AAGATATAGACTGGCCAGATTCACCGAGTACTACAGAACACAATGCGGAGAATGATGATTACCCTGGAGCAGATGACCCGAGTCATCATGCTGAACAAGC
TAGCCTGTCAATTCTTCAGCCGAACTTTCTCACATGCGCTTCGATTGAAATGCGAGGAGTTCAATTTCAGTTGATTAACAACATTGCAGACCAGGCTTCA
CCTGTGGTGGAGTTTGAATTGAAATCTGTCGACTTGCTGCTACGGTCAGAGTCATACTCAACGGTAGAGCTTTCGATAAGTTGTGGAGTAGAAGCGAAG