Description :
From Genome Similarity Track
Location :
scaffold_18:11398- 12459
Transcript NameFunction/comments
Pl_112164hypothetical protein PHYSODRAFT_538430

Sequence
1061 bases(100 bases per row)
CAGCTGTATTTTGTCAGTAATGCAACCCCTGATGCTTATCGATGATATGTTTTGGGAGGCCAAGGATAACATTGCTGCTCTGAGTCAGCTCCATCAAATT
GGATTAATTATTATACCGTATCACTGAATCTGCAGAGTATGTATTCGATTAAACTTAATGCTCATGCATTTTACTAGTGGACTAGATAGCAGCAAGGTGA
AGTCCGAAATGGACTGACCAGTGATCGACGTTGGTTGCATCAAGATAATATCTTCTTATGTCATAATCCAATGACCAGCAATCTAAGGTATCCCGACATC
TTTTGTCGTCTCTGATCCTTCTCAGCGTGATGCTTTTGTTTCAAAAGTGAAGGTTGGCGGCAATAATGTTTATCATACCAGAGACAGTAGTTCTTCCGGT
TCGTGACAGCTCGTTAGTCGAAGGCACCTACACTTCTGATCCATCCAAGTGCATTCGTCTGCACTCGCAGCACCACACTTGATGATGTCCATTTGACAGC
CATTTGCTAGCACACCTCGAGATCCAGTGGATTTTTTTCATGAAAACGGTCTCCCATGAAGACCATCCCGCAGTGGACTGATTGCAAAATCCTCTTCTAT
TTTGACCATGTGACACAAAATTTGGTCTTTTTCTACATACAAAGCGCGAGAGACATCGATAGGTTCATTGGCTAATTTCGACTTGGCGTGTCCACATCAT
GAAGGCTCTACGTGCTGCCGTGTCGGGCTCGCGTGTGCGCTTCATGCAGGACGGATTCGACCTGGACCTGACGTACATCACACCCAAGCTCATTGCCATG
GGATATCCAGCGTCAGGCGTCGAGAAGACGTACCGTAACGACATCAACGAAGTGGCCACTTTGCTCAATTCTCGACACCCAAACGCCTACCGCGTGTACA
ATTTGAGCGAACGCAGCTACGACTACAGCAAATTTGAGGGACGTGTGAGTGAATGTGGCTTCCCTGACCATCACCCGCCTCCTCTGCAGCTTCTATTGGA
CATAATGAACGATATGATCGAGTGGGTGGCTAAAAGCCCCAAACATGTCATTGTAGTGCAT