Description :
From Genome Similarity Track
Location :
Scaffold_329:11397- 12716
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_329-fgenesh-gene-0.2ATP-dependent RNA helicase

Sequence
1319 bases(100 bases per row)
CTCCCGAGGAGCCCGTCGAGGCGGAGGAGGCCAGCCCAGTCGACGACGATGATGAGGTGGACGCGTCGGCCGCTCGCGAGCACGAGGCGGAGGAGAACGA
CGAGGAAACCGAGCAAGCGATCGCTGACGCTGCTGATCTTAACACCAACGTCGACGAGCGATACTTCTCGAGCGAGGAGTTCGCGTCGCTGCCGCTGTCG
GAGCCGACGCGCAAGGCTCTGGCGGACTTGGGCTTTACCAAGATGACCAAGATCCAGTCCAAGTCGATTCGTCCGCTGCTGGCTGGGCAAGACCTGCTTG
GCGCGGCCAAGACGGGATCCGGCAAGACGCTCTCGTTCCTGATCCCAGCAGTGGAGCTGCTGCACAAGGTTCGATTCACACCGCGAAAGGGCACGGGCTG
CATCGTCATCTCGCCGACGCGCGAGCTGGCGCTGCAGATTTACGGCGTTGTGCGCGAGATCTGCAAGTACCACTCGCAGACGCACGGGATCGTCATGGGC
GGTGCGAACCGGCGGACGGAGGCTGACCGACTGGTCAAGGGCGTGAATATCCTTATCTCGACGCCAGGCCGCCTGCTGGACCACCTCCAGAACACCAAGG
CGTTCGTGTACCACAACCTGCAGATCCTAGTCATCGACGAAGCCGACCGCATCCTGTCGATCGGTTTCGAGGAGGAAATGCGCCAGATCATTAAGTGCAT
CCCGAAGGAGCGCCAGACGATGCTGTTCAGTGCGACGCAGACGAAGAAGGTCGAGGACCTTGCGCGCCTGTCGATCAAGGAGAAGCCCGTCTACGTTGGC
GTCGAAGAGGAGGACTCGAAGGCGACTGTCGCGACGCTGGAGCAAGGTTACGTGGTCACGCCGAGCGACAAGCGCTTCCTGCTGCTCTTCACGTTCCTCA
AGAAGAACCTGAAGAAGAAGGTCATGGTGTTCTTTTCGTCGTGTAACGCCGTCAAGTTCTACGGCGAGCTGCTCAACTACATTGACATTCCCGTGCTGGA
CATCCACGGCAAGCAGAAGCAGAACAAGCGCACCACGACTTTTTTCCAGTTCTGTAACGCGAAGACTGGCATCCTGCTGTGTACCGACGTGGCGGCACGT
GGTCTGGACATCCCGGCGGTTGACTGGATCATCCAGTACGACCCGCCTGATGACCCGCGCGAGTACATCCATCGCGTCGGTCGTACTGCTCGTGGCGCAA
AGGGAAAGGGTAAGGCGCTGCTCATGCTGCTCCCGGAAGAGCTTGGGTTCCTCAAGTACCTGAAGGCGGCCAAGGTGGCTCTGAACGAGTACGAGTTCCC
TCTCGCCAAGATCGCGAAC