Description :
From Genome Similarity Track
Location :
Scaffold_81:113968- 116635
Sequence
2667 bases(100 bases per row)
AATATGCATGTCGATGTTGCCTTGTTCCGCGCTACTTCGATGTTTTTGTCTCATGGCGATCATTTTTTTGTGGGACACGATGCTAACCTAGCTATATTAT
TTCTTGCTGTTAACCATCGATCAGTGGAATGTGTATTGCTGATCTTTCTTGCGGCATCAAACGATTGTGGTCATGACGCTGCCGAGCAATCATCATTATC
AGCAGCGGTTAACATAAGGAGCGATTTTAAGATGATTGGTGGTGACATTATCTAAAAGGCTTGCTCACCCCATACACGCAGTCTCTGCTACGCCGCCTTT
CGTGGCGCAGAACTCTATGAGTTTCTGATCTTGCAAGCTCGTCATATAATCACAGGATAAAGACAGGCTCGACATGATCATAATATTTGCTGATGCTAAA
GCTCAGTGCACGGCGCCTATCCAGACGTCGTCGTCTACTTCTTGGCGTCTCTGCGAACTTTGGCGTAGTTTTTAAAACGATAACCGCGCACCCGGTTCGA
GTCGTTGAAACCTCTGCAGAAGACAAGATTCCTTAGGCCTCAGTGGTGGCGGTATGTCGGTAGCTTACAGATTTGTACATTCGAGATAGCGACTAGCACT
CATTGGTGCGCTCTTAATATTTTCCAGATGAATGTGGTGTTACCGCGCGCGTCTTCAGGCGACTTAGCATGCTATTTCAGGTTTCTCAAATTCCATGACA
GAGCGGGACTGAACGACAACACCGACATTAAGACGCCCTCATGGTAGAGATTAAGCTGCTTGGTTGCAATACTTCAACTAGCTATTTCATGAGATTATTT
GCAGGGTACCACACTTGAGAAGGCGCTGATGCGCTGCTTTCCCCTGCCACAGATTTGAGTTAATGATAGCGTCAAAACTGGAACTGTCGTTTTATTGCTA
AAGCGAATTAACGTTTGTAAAGCATGAGCACGAGACGAAAAGCCATTTTCGAACAGGTGCATTCGCGATATGATCAGCTACCAAAGTTTCACACTGGGCG
CCCACGCCCACTGTCGCGAGCTTAAATATTATTTTGCACTGTAAATTACTATAACTATTTTGGGAAACGTTGACCACCCCTATATATTACCGTATCTTAC
TCGATTTACGCCTTCTGATTGGTAGGATTGAGAATATCACTGTTCTGAGAAGTAATTTACAATCTCATTTACAAATGATAGAATACTAGATCTGAATATT
CTATGCATGTCCTTAAGTCGGCGACGTGTGGTGATTTATTATGCGGCTACTCCCTCCAATTTACAATGGAACCCGATTCGCAAGTAGTGGCGGCAACATA
CGGTGGGGACAATCCCTGACTTGAGTAAGTACAATTACCCGGTGCTATTGCAAATCGCTCGCGTTTAACCACCGTACGGCACTTGTCAGATTCCAGCACA
TTTAAGGCGAGGCTAGACGTAACTATTGCAACACTACAGTGCACATGTCATGGAAGGAGATAGTTGTTGTCAAAGAGGGATAGAAGTACGTGTGGGTTGC
TTTTATGGTATTAATCTGTGGTCGCCGCAAAAAGAAACTTTGCGGCGGTGCTCTGGTATGCGACTGGACGGTTTACGTGTGACAAAAGCGATTAAGTGGG
TAACGATTCGACGCTAACGAAGTAAAATACGTCGACTTGTGAGTTCGCTGATGCAGTAAAGAATACAAGAAACGTGGCCTCAACAATGTTACTATTGCGA
GCGATGAGTGAGAAGGTTATACCTGCATCCAAGAGCAGAAGGTCGACAGGGTTAAACCACTACGTGGCTTTCTTATGGTAAAGAGTATTCCGCGATACGA
TGATTAAATGATTATGGTGGAATTATTGACGAGTTGGGGGATAAAGAAGTTTATTTATCTGATATAGCGGTATGTAATTTGAGTTTAGATAGGATGAAAT
TTCCGACGGTAATATTTTCAATCATACCAATCAAAAGGCGTAAATCGAGTAAATTACGGTAATGTATATTTCTGACGGCGATTATCTCAATCCTACCAAT
CAGAAGGCGTAAATAGAGTAAAGTACTGTAATATATAGGGTTGGTGGGGTGGTTAACAAAAATCTGGTGGGTGAATTTAATTAATTTCAGATTTTATAAA
ATTTTTGGCTAACGTTTCCCAATAATTATTGCGGTGTAAGAGGTCTATTTGTACAATATTGTCCTATACCAATAGGGCAAAAAAAACAGGTGGGTGTGGG
TGGGCTCAGCTCACCCACGCACAAAATTTATTTAGCGAATGGGTGGGTGGTAAGCTCCAATTTAGAACCCTGTCTGCTAACCAAAGTGTACCGATTATGT
CTCTAATGGGCGTAAAAATACACCGCTGTGTAACTAGAGTCGTTTGGTCCAGGGAATGTACAGCTAGTTAGCGTATCCTTTGAATCTGAGCTATAAATTA
ATCATGTCGTTGTAAGAAAAGAAAAATAAATGAAGTCACGCATTCTTGTGAGCACTTCATAGGCATAAATTTACCGGGTTGCCACGACTTTTGATACTGT
GTCATTGCTAGTACACGTTGCGAAGCTACATGAAAATAGCAAATAGAAGCTTGTCAACTATATGCGCTCAATACGATCGCTTAGGGCTCAAGACAAATCG
GTAGCTGCAAGGACAGCGGACCACTGGGTGACCTTTATGTGGTATAACACCACTACAAGCGAGACGT