Description :
From Genome Similarity Track
Location :
Scaffold_173:113955- 117941
Transcript NameFunction/comments
Hyaar_Emoy2811872myb-like DNA-binding protein, putative

Sequence
3986 bases(100 bases per row)
CTTTTTTAGATCCCCATAAATACATACTCTGGGACGTTTCTATCGCCAATAAATTATTTCGAAGCAATAAAGTGCCATGGGGACGTTTCTATCGACATAA
ATAATTTTGATCAATACTCGCTCCGGGTCGTTTCTATCGTAAATAAATAATTTTGAAACAAAAAGTGCCGTGAGGACGTTTCTATCGTGAATAATCATTC
AGGAGCGAATATAATTCATGCCATCTGTCAAGAATTGCAGTTTGAGAACGGAAGTCGAATCATAAAATCAACCAATCGGTGGTGCGTGACGTGAAGGCGT
CTTCCAGCGGACCTTATGGATTACGTATTGATTTTGAATTGCCTGTGGAGCAAGTCGCTGCTACTAAATGCAAAAATACATCCTTTCATCTTGTATTCGA
CAATGAGGCAGTCTGCACACATGTGCACGAAATGCGTAGTGTTGCATGGTCCCGTGCTTTGATGACATTTACTATTTTGTAAGTCCTAGTCCTGAACAAT
AGATCTTGATCAACTGTGCTGGGCAGAATTTCTTTGACTCTACGAAATGTCTCGCTTTGCTTTTTGTAAGCGCAAGGGATCACAAAGGGCTGTGACGGGC
TCTCATCTGATCTAGGGTACGGATTAATCAAGCGTCATGCCAAATAAGGTCTTAAATCACACAATTGGCTGTTGGGTGTTGAGACCAACGTTTACGTAAT
CGTCCTGACATCGGATGCTGACGACCACACTAGTTGTAGTAGATCCATCGTGCGACTTGAAAGTTCAATCGCATGAGTGTGTAAAAAAAGTGTCCTCGTC
GCTAGCGTTGGAAACGCAATGCACGAGTCAGGATTCTCACGATATCGTGATAAACCGCTCGTGCGTCGGTAGCTGCGAATATATAGCGTGAGCCCTGATA
AAAAGATATTTTCTAGACTGGCTATGGTTTTGTCCTTAGATGACAGGGCTCTGCTAGTAACAACCGCTGCAAACGGAAGTTTTGCAGTGTGCTCGCCGAG
TCAGGAGCGCAGGAATCAACTGGCAGTCCTACCTCGCGACCATACGTTCTACGCTCATCTGATGCCGCAAAGACTTGCCACTCTTTTTCTCTGACGATAT
TGATAGACGGTGGTGATGGGCTTGCTAGCGAAGCGTGGATTGCATGGTCCGCGTTTCCTGAACGCACCTCAACGAGGGCAGCATTCGAAATCACGCAAGC
CATGGCAGTCGAACGCAGACCGAAGAGTGAAGAACGGCGGTCCGTGGGAACGTGACTAATCCTCTACGACCGGCACGGACCTCGTAGTCTACGTAACAGG
TAAAAAATGATCCGCTCTGGATCGGAGAGTCTGACGAATACGCAGTTGATAGACGTAAACGTATCGTTGCTCTTTTGTTGGACTCATACAGGCATCAAAC
CAGTCTTTTCAATTGCCGCGCAATGTCGGTCACTGCACATGTATCCCAAGCACGCTTGAATAAGCGGAGTTGCTTTTGCATCTCACTGAGCTTGTTGATA
GAGACAATAATTTTCATTACACTGTTAGAAGTTGTGGATAGAGCGGGATGTCAACAGCGACATGATCGTATCGCCAAAAACCGGCCACTCGTTCTCGTCT
GGTCAGCTGGCTGGGTTGAAATCGTCAGCAGCCAGCTGGTAGGCCAGCGCCACACGCGTAATCTAGCTTTTGTACACCACGTAATCGGCTTCGTGGAACC
GGAGTTTTATTGGACGGTCTTGACCGACGCGAATATGACGCGCTTCATAACAAGGCCAGCACTGACGCACGTCAAAAAGTGGTGATTACTTTTAACCAGT
GCGATGCCAATCGACGCAGCATGCACATCAGCAGCCGCATGTGACATGCTGAATTCGAACTGGCACTCGAGTTGGAATCAAGCTAGAATTCCAACAAGAT
TAATCTGCTGGTCCTGGACGCACTAAGTCAGGAAAACTCGGGCGAGGATGGACCATATGTGTTCGTAGCCAACCAATCTAGAGCGCGATTTCCAATCTGG
AGAATCGAATATTCTCGAGTGCATCCTGTGAGTAAGGTGACGCTACCACAGCAATCAAGCTGATATTTTAGCGGCGGCGGTTATATTGACTTCGCTTTGG
GAGTTCCCAACACTGTACAACATTACCTTACAAATATAACCCGTCATGGTTTGGCTGGATGGGACCTAGATAAAGGGTAAGTAGGTGAGCTCGACCTATA
AAAAAAGCGGCACACCTGCTGAACAAAATATCGACGAATACAAGCTCGATACCACTGCGAGTAGGTAGGAGAAGTGGGCAGTAATCACGTCAATGGTCGA
TGCTGATATCATAGATAACCATCGTTCGTAGCTATAACTGTCGCTTTCGTCAGCCGTGGTACCGCTTTTCTTCGCCATGGTAGAGATTATACATACGATG
ACGAGCTCGCGATAATCATGGTAATCTTTTTATCAGCACCTCTTTGAAACCCACTTACTCGAGCTGCTCAGTCTGTCTACGAGACCACAGTCGTTACATA
ACATCTTCGTCACCATAGCTCATGGATCATCTCTTCCAAGACAACAAACTTTCCATTTGAATCGCATCTTCACACGTGCTTGCTTACTTGCTACATCCAG
CGCCGAGTGACAGCAGCGAATCAGCTCGACTCGTCGCAAAGTGTGGGTATAAACCGCGCCGTCATTTATCTACATCGTCAGCGCCTGGCAGTAAACTGAG
TAGCAACTGTCCTCCGCGCCTGGCTCTTGTCAGCTTGATGGTGGTATGAAGCGAGTGGGCGGACGGCTCTGGCAGTCTCGACATGAAGTCAAAGGAGCAC
AGCCGGGTCCCTAAGGGTCGACCAACCGTCAAACAAACGTGCATTTTTCAACTCGCGACACATTGAGCGAGCGAAAAACTTGTGAAGCCACTTCAGCTGA
TAGCCGGTTGGTTGTCTGTCGCTATTTCCACCACCATCAAGTACCATTCCACTCTTGTCTGCAGTCAGTCCATTGTTGTACCGATGACTTGTTTCGGATC
GAGCTCACCGTTATCGGTCACTATGCGGGAAGCGACGTCCATGTCGCCGACAGCAAAAGGAATTTGGTCCCAAGACGAGCACGACCGCTTTCTAGAAGCC
ATCAAGCTCTATCCCAAGGGACCATGGAGGACTATTGCAGATCACGTAGGTACCCGGTCCGTGCGACAGGTGCAAACCCACGCACAAAAGTACCAGGAGA
AAGTGTCCCGTCGACTGCGGGGGCTCCGCAAGACCAAGAAAAAACTCGTGCGTCCGGAACACCGTATTGATGAAGACACAATGGAACTCTGCAAGCTGGT
GGACTGTGCTGCGGACAAACTGGTGGCAACTTGTAGCAACTTATCGTCCAGAGCTACGGGCACCGAGCTAGAACTGTTGCCGAAGGAGGATCGGTTACAG
CAAGACCTTGCTGAGACTACTGGCAGTCCGCGGGGCCCTGATATTCCAATCAGGACCAACGACTTTTTGCCATTGCCGTGTGTCAAAGTCGTCGACGAGA
TCGAGTTGGATCCAGTCCACATCCCCACCGTGAGCGAGTCACTTGACTTTCTGATCGAGTATCTGTCGATATAACTCTGCAGCTGAGCGCGAACTGATAC
CAGTGCAGTAGTGACGGAATAGATCGTCATCACTGGTAAAGGTGGATCCGTCATCAAGCTGACTTATCGGATTTAGATTAGGAGGCTTCATATTTATGTC
GTAAGGAGCATTTGCAATACAAGCTTACTCGCGGGGACTGAGGTATGAAGCGGAACAGCTCAACCACCGAGATCGATACATGACCGGAGTCAAGCTGCCG
CTTCTGATCAAACAGCCCCCACTTGACCTTTTGACTACAGCGTTTCGATTCCAATGCCCGTGTCATTTTTGCCTGTAGTGCTGCTCGAGTGAGGTCGTCA
CGGCCACTGAAAAAACGGTATGCTCACATCAACCGGCAGCACCATATTAGTGAAGTGCCCTACGAGTGCGTGCGGTTCTTACGAGC