Description :
From Genome Similarity Track
Location :
Scaffold_15:113954- 118001
Transcript NameFunction/comments
g3102.t1RAW27272.1 hypothetical protein PC110_g16342 [Phytophthora cactorum
g3103.t1ETO62573.1 hypothetical protein F444_19527, partial [Phytophthora parasitica P1976

Sequence
4047 bases(100 bases per row)
TGAAGAGAGAGGCCCAAATACCAGCGTGTTGAAGACACTATCACAGAAGAACAGGAACTCCGTTTTTAGTCGTTTCAAAGGACTATTGGGAAAGAATCCA
ACCAAGCTCACCCAAAAGAATGTCGAGAACATCAAGGAGAACAGCAAACTCAAAGGGCTACTGAGCAAAAACCCGTCGACGCTCAGCAAAAAGAGTGCTG
GCAGGCTTGGGGGGTATTTGGCCAAGAATGGCTTGACGCAGATCTATTCACGTGCTGTGATTGCACTGTTTGGAGCAGGTGCATTGGCAGCTTTGATCTA
TGTTCTGTATATGAGCATCAGTGCTGCTGTAAACTCATCGAACTAAGGAAATACATGTTGGCCGACTCGACTCTTCGAGTTGCTACCCTTCGCGTGCCAG
AAGAGCTACATGTTGTTGAAAGGGGGAACGATACGCTTGGGGTGGTCTTATGCCCTACTTGTTTTTTTGCAGACTGATTCATCTTCCTTACCTACTCCGC
AGCGAGCGAGTGGCCCACTGCCGATGTCGTTTCAAAAACCTCCGTCTTGGTTTTGAGCGCAGCAATCCGCTGCTAACCGACTCCACTACGAGGGCACGGA
TGCTCTGCTAGGAAAGGAGACTCGGCGAATAGAAAAGAAGTACAGTCTCGTAATTATTTCCCGGGAAACTGATGTTGTCTGGTGGCAAAGAACCATCATT
CGGGTTTTACATGTGCAAGAAGACCATCAAAATATGCGTTTCGGTGTTTTCGACATGCGTAGTCACACGACCATGGACGCCGTAATGTCGTTTGAGTTGC
TATCGTTTAGCGGGTTTGGCACTACAGAAACCAGCGAGCTGACAGCAACCTCAGCGAGCTGCAGCTGGCGAGTGTTTACTCGAACATGCGCCAGTTTATC
GCTCTTTGACGGGCCAAGTTGTGCACGAAGCTGGTGTGGCAGCACACCCGTCGCGTGGGTTGAGCTGACTGCACACGCCGGCATCACGAACACGCGACAA
GCGATAGCCTGCAGCGCAGACCACTTAGCGCCGTCGCAAAACCAGAACTGTAGCGGGGATTTCTTGCGCTCTTTCAGCTTGCGGAACTCGACTGAGTCCA
CCTTGGCCGTCTTCTGGTGCAAAGCAGTCTTCTGGTAGTCCTTGTATTGTGTGTATAGTACTTCCTTGTTCGTCTCCGAGAGAGGGGCGCCGTTGACCCC
AACCGAAGACAACAGCAACTGCTCCACCTGGGACTTTTTGTCGACTGAGAAATCCTCGCCGAGCAGCACTGGGTCCAATAGGTAAGCCAGTTCGTGTGCG
GTTCCAAGCACAGCCTCCTGTTGATGCCCAACTAGCGTTCGCAGTACGGACTTTTCTTCAGGTAGCAGCAACGCACTCGATGTAAACTCGGTGGAGAGTT
TCGAAAATGAAGAGTACACCTCTGACAATGGCAGCGGCGATGAATTGGAACTCCCCTGAAATGCTGATAGAAGTTCGTGGAGAGGACGTACCACATCCAG
ATACTTACGCAGCTTTTCCGAGAACTTTGGGCTGCGTACGAACTCGAGAAGCTGCTTATGCAGAATGGTTATACTATCTCCACTCGAGAAAAACTTATTT
TCCAGTCCTTCCACGTCCAGAAACGCCTCGGCTTGTAGGACAGCTGAGAAAGCATCTTCGACCGTTAATCGGCGCCTCACAGTCACGTGTGCTGTGTTCT
CTGTGTTCGCAGCGGTCTCGGGAAAATAAGTCAGAGGTTCGCTGTCTGGCACAAAATACACGAGGTCCTTGCACTGCAACGCAAACTGCTGCAGGTCTCG
GCAGAATGGCGTCGCCTCACCTCCTTCCGGTTGAACGAAAAGCTGCCGAACAATCGTGAGCAAAGCATCTCGCATGCATCCATGGAAGTACATGGCTGGG
AACTGCGTCTCCAGCAACTGCCGCACTTGTCGACTCTCCGGAGAAGAGCAGGGCATCACACACCCAGCAACCGGACACGACAATTTCTCCACCACACGCG
CTACATCTCGTGCTGCCCAATCCACATGTGCGACCTCATCACTAGGAACTTCAACCGACTCCAAATACATTGGGAACTTTTCCGAACTCGCCAAGCTCGC
CATATAGTTCATCACCAGACCGCCTTCCGAGTTCGCAGGAGCCTTTTCGTACGACAGAGAAGCCGGCACCAGTCCACTCTTGAAAAACCCATCCACCCGA
GTTCTCACACTATCATAGCACCGATCCAGCACCTCCGTCATCAACTTTTCCTTGTCCGGCAAAGCAAAATCTCCACCGCACACTTGAAAAGCCTGTGCCA
AGAACGGAAACTCGAGTTTCTCATCTACGAAATTGTCCGGGGACATGGTCGTGAACAAGTGCATGGCCACGTGTTCCTCGATCTTCTTGAAATTCAGCTT
CTCCATCGATTTCACTCCGTTGTTTCCTGTATTTGGCATCATGGGCATCTGCATCACGGCGGGCTGGATGCTCTTGAACGTCTGAGTCGGGGTCTGGGTC
GGAATTGGGCCCTGGAAAATGGGTATATTTGCGCCTCGGTTCAGTACCAAATGTTGCTGTCGTCTTGTGACTTCGGCCAGGTACCACTCCGGGACGTCCA
TGGGCGGCAGCGATTCCATAAATTGTAGGAATTGGGCACATTTCATCAAATGGGTGCGCGCCTGGCCCCATTTCTTGTGGTGGTGCACCAGTTGCTGGCA
GTGGCGACACGTGGCCGACGGCTGCTTCTGCGGCTCTGTGACGGTCGTGAAGAAGGCCCAGGAACGCGACGGAGGACGCCCGCGAGGCCGACGAGCAGCC
TCCATTGGCTTCGTTCGGTTGGCTTTGGAAATGGGTGAAAAACCTGGCGGTATAAATTTGGGGTGGTTTACTTAAAATAGGCATTCTTATTTGGGTACAA
ATGTATCAGGAATTTGGCTTGCGAAGGAATTGTTTTGAAAAGGCAACTTAGCCGCGCACCAAGACGGATCGAACTACACGAGTGGCGGCAAATTCGAAAA
TGAGGGACAGCACGCGTTGGTCCAATTGCTGGATTGCTGGGATGGGCTCGTCATCATTTTTGTCATCTTGAGGGCGAGTGGCGCTGAGGAATGCGAGCTT
GCTGGGAGATGGCAGTGGGCGTGGGGGCAGAATTTGGCCGTCGAGCTGTCGTAGACGACCCTTCCAGATAGCACTCAACATTGTGCGCGACACGAAGATG
TCCAACCTCTCGAGGGTTGAGTTCTTGCCCATGGCTACCCACAGCTCACTGAGTGTGGAGTGGTCCAGTGGCTCTCCGTACTCTTCGGCGTAAATCGCGA
GCTCTCTCAAGTGTTTTCCCAAACGGGTCGTGGGATCTCCAAGGCGCTTCATAAACAGCTTTCCATCCCCATCGCCAATGGCGTAGACATCCTCAAAGTT
CAACGATAAAATGGTTGGAAAATCGTCGCTGCCACTTTCGTACACGGTGGAAAACAGATCCAAATCGATGAAGCTTTCACAAAGCGACAGCTTGGTTACG
CTTGGACAGGAGGCCAGAATTGTCGGTACCACTGCGTCGACGTCCATCTCACGGTGGAATGACAACGACAGCTCACGAAGAGACCATCCAACGTGCTTGA
TCAGTCCTTCTACTCCCTCTGCATCTGCCCTGAATGAAAGAGAAAGAGACCTGAGAGGCTCGCCTTCTGGTTGCTCTTGCTTCTGGGTCGTCACAGCCAC
AACACTTTTACGAGGTACGCTACAATGTCCATAGCCGGGAACAATCACATCCAGCTTGTTGGCTTCACTCTCATCATTGCTCTCATCCGAGTTACTCCCC
ACCAGTTCCACAAGTGTATCAAACGGCAAGCCTACAGGATCCCCCGTCACAACAATCCTTTCCTCGCCTTCTTTCTCAGTGAATTGCAGCGGCGTGTTTT
CGCGCAAAAGCCAACTTTTCTCGCAGATTTCCCATTGTTGCTCGATGGTGGCTTGCTGGTCCTTTTCTTGTAGAACAGCGCTAACCTCGGCCAGATCGTC
CAATGTCAACTCTGCATTGGGAATATCCAAGCCACGAACTGACGAGA