Description :
From Genome Similarity Track
Location :
Scaffold_279:11395- 15872
Sequence
4477 bases(100 bases per row)
AGGCTGATGTTGCAAGAGGAGGGGTTGTATGCACTCTATCGTAGTGGTGCACGCCCCATTGTTCTGTGTTGGGAAGTGTGGGTTCGATTTCGACGTGGGG
GTTGCGAAAGGTATCTCGTGACAGCTTGCGGTAATTTTCTTGTACATGTACTTGTTCAGACCTGAACATAATAAAGAGTTTGGTGCAGCTCGCTTCGTTC
TAGGTTAATAGTAGGGTGAGTCCTTTAGGTCAGACCGGTTTATCGCTGGTGGAAGAACGTTCTACCCTAGCAGTGATGACTAGTGGTCGCTTCGAACAAT
TCGAATGGAATTGCTCCCTGGTTGCATACGTTCTTGACTGGCAAGTCGCAAAACATTTTTTCCTACGAGTTACAGAAATATATTCGCAGCGTATATGAAG
AGAATGAGATGATTTTTTGATGCAAGGCCTCAACAAGGCGGAAGGTCGCACGGTTGTGTCTATTAGTGCCAACACGGTTCCCGCGCTGGTACAGTATACG
CACCCGGTCGCCGGCTTCTTTTTCCCGCGATCTAACGCTTCTTTTCTTGGGTCTTCCCGCCTAACGGATATATTTGCTGGTGGAACGCCTTGGTTGTCGA
CAATACTGTGATTCTCGGGAATCAGCATGGCACCGACGGTCGTTTTTTAAGTCGTGACTTGGTAGCACTGATTTGTTAGCTCAAAGATTTTCTTCTTCGC
GTTGAGCGCCGCGATAAGATGACGACCTGCAATCTTCAACCTCAGCCAAACCTCACACGAGCAAATCATTGAGATCGTGTCAGCTATTTCAATGGCTTAG
TGACACGGCAGAAACGTGTTCGTTACTACCTACTGAGGTGTACTCTTCGGCTGGGTTCAGCTGGTCTGGAATTTGGCCTCAGCTCGAGGAGTGACCGCAC
GTCCTACTTTTAATTACAGTTGTACGTGCTGATTGCGAGCGTACACATCGCCCATTAGTACATTTGCGTAGCTCTTGAAGCGCTCGAAGGGCAACATCAT
TCGGGGTTTCAACTTCAAGCTTGTTTATGGCTGTGCAATAAACTGAAAAATATTAAGATTTTAAAAATATCCTGTCACGTTCTGGTGAAAATTTTAAATT
CTGTCACCTTTTGCAATTATTCCTACAATGAAAGCCACTTGAACACTTGATTGTAAAATGAAATACGAATGTATTAAGGCTATTAGTTCACTATCTCTTT
TTCTACTCTAAGTCTACTAATTACTTTGACTACACATTCGTAATTTCCATACGATCATTAATTATGTCCCCCGCACATATTCTGTATTGTTTCCCGTCCA
AGGCACTTCTCACTTTCACCTGAACTGGCAGAACTTAGCGCCTGGATGTTAAATTGCTACGAAGATGCTGGAACCGAACAGTCTTGATCAGATTCGACAT
CAGGTCGGCTTTTCCGTTTTTATACGAGCAGTGATACAGAAAAATATTTCCTCTATAGCAATGATTTTGCGCCCAAGAGGCAGCAAATTTCGGTGTATTC
AGTGCTCTTGAAGAATTCGATCAGCGCTGTCGACCATTTTATAACCTTCTGTATATAGATGTTGGACCGCTTACCATACAAAACAGCCCACACAAGAACG
CCTTTCACCAGGATGCCTATGCGTAGCCTCCGATAGCGTCATATATTTTTCTTTCGGGAATGATAGTGTCACCGGTCGTTCCTTCTTGTTGCTCTATCAA
TTGTATTAGTCTTATATTTAAAACGTGTAGAACCTTTACTTTGCCTTGCCTAGAAGTCCCCTGCCCGGTCCGCATTTAGATAGCCTTGATTTCTGGACTC
ATTACTTGCTTAGACATTAAGTGCCATGCCTCGTCAAGCCTTAAAAGAATCGAAAGGTAACTCTTGAGTCCGATTGTGCCAAACGTGAATCCCGGGTGGC
GTCAAACGAAATGAGCACTTCCACTGCACCTGCAAGTTTGGGACAATTGCCAAGCATGAGGTAATCATCCAACAGCTTTCCGGTGAGGCACGTTTTCTAT
CGTTTCTAGAGGCATGAAATTGTTATTGCACATGAACTTGGACAACTTGAGCCCTGAGTCTTATGGCGACTTGACTGAGTTGCTGATAAGCATGCCAAAA
TTCTAAAGAATGTCTATAGAAAGCTAGCCTGCCGCAATGCCATAACTTGATCTGACCCATGCATATTATCTCGAACCGCTTACTGTTTGAACCCTTGACT
TCATAAAGTCTTGTTGATGCTGCTGGTATTTACTATATCACCAACTAAAGTGAAACAAAGATCGTCAGCTGTGCATCAAGTTTAAATTAGACGCAGTGAT
AAGACTTCGATTTCTCGAGCCCGATCTTGAAGCATAATTTATGCAATTGTCTTGATCTGTGTCCGCTTTAATAGCTCGAATTTTACAGTGATCGCTATAG
CTTGCGAGCTAGATTCGAGTATACTTTCGAGAATCCGTTTGCCATGAGATGCTCATTGGACCGATCTAAACAGCGATCTTGATTTTCTTTGACTCTAAAA
ACCCTCCTGCCGCTTTTTTTATGCTTTGGATAATGTACTAGCTTCCATAAAAAGAGAGTAGCTTCATAAGTCAAATACTTCATCCACTTCACTACGGTTC
TCGATTCCATTGCTGACTTGATGGAGTCAAAAAAAATTACAAACTCATAAAGCAGTAGTCTGCTTTAAATTACTTCTCGCCTTGTGCGACCGCTAGCATA
TCTTCGATAATATAGCTCTTCGACTTTTCCGCTTCAGATTCGAATTTTCACCGTCTGCTCAAATGAACGAGTTATAGAATGTGTTAGATGGTATCCATAT
TGTAGTCTTGAGCATTGCCTTCTTTTTAAAATTCGTTTTATCTGAAGGACAGGGATATTCCCATGTTCATTCCTTAGAATGTCCAGAACGCAGTTCTTCT
ATTTGTTTTGTCTCCCACCGTCAAAGATCCGACTATACGATAAAGCGACAACGCACAGACTGTAAGTTAAATTTTGTCCGCCCTGCTTTGATACCGTCAC
AACACATGTATATCTAAAAAAGACGCTCGTTGACAGTGTTATCGTGCCTGTTCAGACTTGATTTTGCGAATCGACCCGGATGGTGGCACACGTCGCGTAC
ACCACTTGCGGATTAATGAAGAAGTTAAGTCTGTGTCACCTCAATTTTCATGTACAACCCGGCAAAATTGTAAAAGCTGCAATATCAATTATCTAAGGTC
CTGTTCACCATTCCACCAATCCCCTTCACTTAAAATGTAAAGGGGGACGTAGAATTCTGTGCGATTCACGATTGCTCCAAAACTTGAACATCTCGTGAGA
CTTGTACTCTACGCCGTTTTTAAGTCAAAGACGCGGCTGTCGGTATTATTTTACTCGTTTCGACAAATTTGGCAAACTTGGCAGCCACTATAGTCTTCTT
GTGAATACACTCAGGCTGGAAACCAGCCTATAAATTTGACAAATTATCGGCTGCCATCGATTTTAGCAGTCTCCATAGGACCACATGATCATTGTGAATG
AATTCAGGATTATTTTGCATGCACTGTAGAATTTGAAACAACTATTGATTGCATTTGCTTGTTAATATTATAATACCTAGGCGTTATTTTCTACTGCATC
GTCGTGATGACTGAGTCAGACCCGCAGACCTTCTTGACAGTAAATAAAGACCCTCATGGCCAATACGATGTGGTGGTTAAATATCACCGTTCGTTCTTAG
CACATTGACTCGCCTGGCATAAGCAAGGTTATGTAGAAAATGAAAAAGCCTTATCCCATGCGCGCAACCAAGTGCTTTTTGGATATCTTCGCCTGCGCAA
AGCCTTTTACACACTTGAACGAGAGGGTTTTTTTTTCGTGAAGCGCTCTACCATGGACAGGTTACTTGTCAGCTTAGAAAAGTGAAATCGCCAGTAATTT
TACCATTTTTATGCCGTGTTTATATTTTGACACGACGAGGTCGTCCATTTTTACGGCTTGCAAAACACCATCGTCCTCCAATAAATGCTACCAGCAAGAT
ATTCTAGTGAATTACATGTACTTTTTATGTATTTCATGAGCTGCATCACACGAGAGTTGACCAGCCGCAATTGACTTGGGATTGGTGTTGCTGTGTTATG
CAACACAGGTAGTTGCCAGATATTTTATCAGTCTGCGCGACGCTTTTAAGTTCTGGCCTCTGCCGCTCCACATACTCGTAGATACTTCTATTACCCTTGC
CTGGCAATACAATGTCCCACCTTCGCAACAGAAATTAAAGGCGTTGGCTTCCTGCACAGTCCAATCATCTATTTATGCTGTGATTTTTGTATACATATTC
TTGAACTTACTTGTTCGTAGATCGATGGACGCCACCGCTGCGATCCATATTTATATACATCATCCAAGATGTCACGAGTTTCTATGACAGTGTCGACGCC
ATGATCAGGTACTGGGACGACTATATCATGTTAATAAAATGAGCGAACCGCTAGTCGCTAAACAGAGAGCGACCGCG