Description :
From Genome Similarity Track
Location :
Scaffold_419:113939- 117577
Transcript NameFunction/comments
Aphin_H310_00868Hypothetical protein
Aphin_H310_00869Hypothetical protein

Sequence
3638 bases(100 bases per row)
ATTCTCGACAAGATTTCCAGTGTCAGGCTGAGTTCGAACGCCTAGTGTCCATGTAAGAAGAACCCTTGGCATAGGTTGGAGAATCTCGCAAGTGGCAACT
TCAACTTTGAACCGACGCCGTCTCCTCCACGAGCACAGTAAGACTGCGCAACCGAGGTGCTTGAGCAAACGCATCGTGGGTCCTTCTCAACCAACGATGG
CGTGCGACGATTCCTTCCATGGTGATATTCTGTCCGCAATTCGCACCCGACCCATCCATTGAAATGAAGATCACATTCCGTCGACATGCCACACGAAACT
CCCTCGTTTGAACACTGCGCCTTCAAACTACTTGGAGTGAGGCACTTGTACATGCAACCACGCGAAACCACAGGAACACACATGATGTCACGGACGCTTT
TCTCCGGGGGGGGGTCAGAAGTCCACATCCATGATCGCAGCAACGTGGATGGTAGATCATGCAGCCCCGCGTGAACTATCCACCACTCATACACCCTAGA
GCTTGCCGCTCCTGCCTTTGCTGCCCTCGCCCTCGCTGGCTACACCCGTCAAACCCCACCACCGCTTTGGTTGGCTTCCCCGAACACGTTCGGCCTTCAT
CGTCTTCCAACGACCAAGGTATGTGGAGGCGAAAGCTGAAACTCCCTAAACAAAAAAGCCAGCATACTTCATTCAAATGACTATGTTCCATACCCTAAAT
AAAGCGCACCTATGTCCCCGATCTACTGTTGGGTTTATCCCCGAGTCACTTGTTTCGAACGTTCCCGTGGCCTTCCGTTGAATCCTCCCTTATCCGAACG
GACCAATCGCTGGCCCCGTGGAGGATTCGCCGTCGTTGATTGGTGGCTTCCGCCGTGGTCCGTTCCAAGTGGTAGCGAACCAACAACCCGGTGGGGTGGC
CCACAGCGGTCATTGTGCGTTCCTCACCCGCGCCCGCAGGTCGCTCGCAGTCTCTCTGTCCAGTCGACCACGATATACAATGTCGAACGGCGGCAGCATC
GAAGGGTACCTGATCAAAATCGACGACGAGTACGGGTGCATCGTGTACTGCATCCTCGAAGAAGGCACGTTGCAATACTACAACGGCAAGGGCGGCGTCC
TCCTCGGCGAGCTCCAACTCTCGGGGAACAAAGTGAACGCGAGCCTCATTCGCAACGACTTGTCGTCGCTCCCGAACCGATTTGTCATTTCGAGCCGCAA
GCGAACGTTGGAAGCGAAGAAGCAAGCGATGAGCAAATTGTTTCCACCCGAGCTCGAGCACGACCAACGCCTCCTCTTTGCCGCGTCGACCCCCGAGACC
CAAGAGGAATGGGCAACGGTCGTCCTTAACTGGAACAAGCATTGCTGGGACGAAGCGTCGTCCATCTTCAGCTACAAGGACGAATTGCACGCCCTCCGCC
AGTTGCTGCGAACACACAACGTCAAGGAAAAACCGCGTCGAATCAACCAGCCCGGCAGCGGCCACGCCGTCCCCGTGCGCTAACGACCCTCAGCACATCG
ATCGTCCCAGTTTAAGTTAATCGTTTGTCGCATGGTTTTCAATGCGGTTTGAGCCTCGAGATCACCCTCCCTCCGCACCCCGCGCAGCAGCACGACCGGC
GCAACCTTCGAATCGAACGATAGATGCTGGTACTTGTCGAGATCGACCTTGGCTGTTCCGCTATAGCCGTGACAACGGGGCCCTGGCAGCGAGTCCACCA
CAGAAGTGCGACGAATTCTCTGCGTCGAAGGAGTGTCTCGTGGCCCAGACGAACCAGCAAGGCAGCCGCCTGAGCGTTGGATACTGGAGAGTGTCCTCAG
TCACCTCCGGCCACATGCATCTCCTTCGGCTCAGAATTCTTGGCGCCAATGCCATGCCCATCGCCCTCCAAGTCGTGGACTGTCCGTGTCTAGCGGCTGT
CAATGGACGACTATGCCTCGACTGCACAGAGATCAACGCATGAAAGACTCGCCGTGGAATTCGTAGTGTATTGGATGAATATTTCGGATGATGTGGGGAG
GCCATCGACGGGCCACAAGTATTACATTTCATCTACATCGACGGCCCCCCACCGTGGTTGAACGGATCTATCTACTTATTGCTGCATTAACTGGTTGGCT
TCGTGGCGCAGCTTGTCAAGGACATCCATCGCCTTTTGGAACTCGACCATGTCCGCCTTGGCCACACACTCGGCGACACGCTGGGCCGCCAACGCCAGGC
GATCTTCTAAACTCACAGGATTTGCCGAACTGTCCGTCGACATGGCACGGGGATGACCGCGGACTATGCCGGGCGGTCGACTCGGCGACTTTTTCGGCTT
CTGCCATCCCCCCCCCTGCGGCGCAAAGCCGGGGGGAGCCGAGGTCAAGTCGTCTGGGAGTAAACTCATCATGCCCTACGACGTTTGCATGTAAGCAATC
TGGATTGACCAAAAGACATGAATGTACCAGTGAGTTCTGAATGATTTCATCTTTGACCCGGGTCTTGTCCTCGCTGCTCAGACTGCCACTCCGGGCCAGT
TGGGCAACTTTCCGAAGCTTGGCACCGTTTGGACTCATCATGGGGAGCCCCGCTTCGTCGCTGTCGCAGTCGTCATCCATCGGTGGGGGAGGCGGTGGAA
TCGACAGCTTTGGACCGCCTCGGTGGTTGAAATAGGGCACAAAATCATCCGACGCTTTCAGGTCCTCTACACACAGTCTCCATGAGAGGTTCGTTTGCTG
GTTGTTCGTACCAAGGTCCGATGCCGAGAAGCGCTCTGGCCCATACCCGTCCTCGCCACCTTGCTGCTGCAACATCAAGTCCCGCTCCTCCGCCGACAAG
TACCGGCCGTCTTCGCCGTTCAATTCCAACAGGGCTAAATCCCGTGCGACGTCCAGTCGACTTTTGCTGCGTCGGCGGAAGCGGTACATTTGCGCTGCAT
TGCCAAAACTGCCACGGCGAGTCACTTGAGGCTGTGCAACGGCACTGCTCGGGTCCTTGCTGGATTGGCGGACTAGCGGAGTGGCATTCAGTTCTGCAGC
GGCTGCCGCCGCCGCAGCCGACGTTCCCGACGTTCCGCGATGAAGCGGCATGCGCGGGGGACTCGGAGCGCCGTTCGGGAGACCGCCCTTCGTTTGGGGG
TACGCCTGGGCAAACTGATGGAATGGCGTTTCAGGCACAGACACAATTTGTTTCCGCCCCGTCGGCTGCTGGGGAGTGTGCAAAACCGACTCGGCCACCT
GCCACGGCACCGTCATGGATGGACGGCGAGTGAGGCCGGGAGGAGGTGGCGGGAACGCGCCGTTTGGACCCGACTGGTCGTAGTCGTCCGATGCAGGCGC
GGCCGGCGGGGGATAGAATCCCGGCTGGTGATGGTACAAAGAGAGCGTCGGACGTGAGTCCTGCAGGGATTTCGTCCGCATCGGGGGAGGGGACCACGAG
GGAAGTGCCGTGGGGACGCCAAAGGAGCCCAGGTCGTCGCCTGGAGGCGGAGGCGGGAACGAGTCGGCTTCGAAATGGACAGCCTGTCGGCCCTATCATT
CTAACTCGTCAACGAATGGCGACCTCGATCGAGACAAACCAATGTCGAATAGCCAGACAATGGCGGTGGCGGGTCCGGAATGGCATCGTAGGGATGGCGC
TGGCTGTTGTTCATATGCCGCGGAGAAAACGACTGAGG