Description :
From Genome Similarity Track
Location :
Scaffold_7:113877- 115895
Sequence
2018 bases(100 bases per row)
GGTCGCCTATTTTAGGCAAATGCTAAACAGCTAGGTTCATTTTTATTCGGATTAGTCATTCTGAAAAGATTTCAGCAGTAACCCAAAAGTATTTTACAAG
TACGCTAAACTTCGTCAACAGTAGATACCACATAATCAATTTAGTAGAAATATTTACTCACTTGCCCGTCAAAAGCTCATAATTATGATTTTGGTGCAAA
ACAGGCTTATTTATACCTTTCTCCAGTTCTTCCTTCTGCTGTCAGCGTTTCATACTGAGAAACATGTCGATTTTGACGCCACCATATTTGGACAGTCTAT
CGGTCCACCAAACTTGATGCACCGCACGATCGCAAACGCTTACGGTGGGGCATATAAGTCGCCTGAAAGTATTGTTAGTGGCGCCCTTTTTACGTAGTTT
TTCAGCTATAATTGCTATCAGCGAGATACTTACACCATTTGAATTGCCGCAGTTGTCTACAAGCATCAAATTCGCATAGTACAACAAGACATGGATGTTA
GTGATAATAGATGAGTCGAAATTTTTTGGTGTTTGCAGTCTCACGAAGGTCCCCGATAGTGTCGGGAGTGGGAGCACGAACTAGGACACCCAACACTTCC
CGAACCAGGATGTAATAGTGTTCTCTAGCCATACCGCCACACTAGCCAAATTAAAAAAGTCAACAGCGCTGTGGATTCTGCCATTTTTCGTTGCGCCTTA
GCGATCTGTTTTGCTCCATCGCTTATGTCCATCCAAGCTGATTTCTGCAGCCGAAGCTGATAGACCCATAGAACCTATGGGTATTATAACTTCCCTGGTA
TCTCACTTCCGGCATCTTCGTAACTAGCGTGATGCAACTATCCAACACTACAGAAATGTAATGTCCAACCAATTGTACATCGGGTTGAAACGCGAGGGCT
ATCACGAGAAACTACTTTTGGCGAGGGGGTAACTAAAAGTTAATTTTAAAAAGGTAATTCGGCGATATTCAACACATGCGTTTTAAATGACGACTTTTTT
ACACTATGCCTAAAAGAATGACCAGGCCTAATATAAATGAACCCAGCCGTTTAACATTTGCCGATTTTAAAGTGGCCGCCATCCGAGAAATAAACGTTTG
GAAATCCTCATTTATGAATTTTTTGACGCCGACATCGATTGCGAACCGTCTAAGTCACCAATTGTCAAGTATGAGGGCTTCAACAACAACTTACTGAATG
GCAAACAGAACTATTTGAGCCTAGATTTTGAATCGCCTGTAATGCATCGCTATTGCGACTTAAATCTTCTGAAATAAAATCACACTAACATGCCTCTCTA
TTTTGCTTTTATAAGCTATACTAAATATAAAGAAACGTTAACCACCCACCAGGTTTTCGTAACCCCACCCACCACACCTATATATTACCGTATTTTTTCG
ATGTGCGCCTTCTAATTGGTAAGATTAGGAATATAACCGTTCCCAAAAGTAATTTACCTCATTTCCAAATAATAAAATACTAGATTTGAACATTCTTACG
CAAAAAAGACTTTGAGGCATACATTTATGCCATGGTCGATCATCGTCTGAGCCCAATCGTATTCAAATGCATCACGCAAAGTCTTGGCACCCGAAAGGTT
GATCTTATTGAAATCCACATTAAATCCGCCATATCAGATAAACAATCTTCTTTATCCTCCATCTCGACAGCTTTTACACCACAACCTTAAACTATCGGAT
CGCGGAATCACCTTTCTAGAAGAAAGTTACGTAGTGGTGTAACTCTACCCACCTCTCGCTCTTGGATTCAGATGAAACTTTAATGGTTATGTTTCAGTGT
ATAGTGAACGAAGTAGCTAACCCTTTTCCAGCAACTTTTTTCTTCCATTACACGTGCACTGAAGTCTTTCACTGGCTTCGCCTTGATCTCCCCTTTAATG
TGCTAGAATCTATCGATATTTACCATGCGGTGGTTAAACACAAGCGATTTGCAATAGACAAGGTGTTTAATTTATGTCATGTACTGTCCCCTACCGTCGA
TTGTCGCCACTCCTAGCT