Description :
From Genome Similarity Track
Location :
Scaffold_360:113868- 114980
Transcript NameFunction/comments
Aphin_H310_12601Amino Acid/Auxin Permease (AAAP) Family

Sequence
1112 bases(100 bases per row)
GACTTGTATGTCACGTACGCGCCCAGGACAAGCGACGCAATAATGGCAAAGTACGCCCAGATCTTCTCCGGCCACGACACGCGGTTTCCAAAGTGCTTCA
AGTAAAACACCATTGGCAAGATCATGCACGACATGGCGATGCAGGAAGCACCAGCAAAATCGAGCAAGTCCAAGAGTCGCTCTTCCCACGCACACGCAAT
CGCGACGGCGGCAGCCACAACAATGATACGCATGGCCGCGATCTTGGGGTAAACACCGGGCTGGCGGTACGTGGCAGCGTCGCGGTCATGATCCTCGATA
TCGTGGGAGACATCAGCAACGGCCAAACAATCACTGTCCTTGTCTGCTGCAGGGGTATCAGATTTGTCATAGCCAGCCTCAACGACAGCTTCTAACGCAA
AATTATACTTGTGCAAGCCAAAAATGACGCGTTCCAAGATGTAAAACCCCGGGGTCATGATCACCGCGAACGCGATCGTCACGTGCAGCTGCATGGCCAG
CATGGCAAGGATCACCCCGCCACGGTTGGCAGTGAAGCCGTTCTTGGTCCCCGCCACAGCAAACAACAAGTTACCGGGAATCTGGCATCCAACGGCGGAC
ACACCCGTGATGGCCACCGTCATGAAAAACACCGAGATGATTGTCAACGTCACGTAGATGATACGGGGCATGCGAGTGGGGTCCGAGTGGTCGCGCTGGA
GGGCCGGAATCACAATGCCTGCACCGTACGCCAGAGCCAAGTTGCCAAACACTGTCGCGACCTGCTTGAAACTCGGGTCGGGCTTGGGCGTCGACACGCC
CGCCGTGTTTTGGTCATGCATGCTGTCCACCAACAGGTACAGCGCAATCGCGTCCGCGACGACCGTGCCGAGGCAGCCCGCGGCGGCCGCGCCAGCACCC
TCCTTCAACGTCGGGATCAAGCATACCGGCAACAACGACAAGCCCATGATAATGATCCAGGTCGTCGTCTCGTACGAGTCGGGAAACATGATGGTACACA
TGGTTCCACCCAACACCAAGAACGCAATCGGCACCAGGATGCAATTCAACATTTGCGAGACAGTCATCAGCCAGCGGCCAGTGCATCCCATGACGAACTC
GCCCAAGTCGCC