Description :
From Genome Similarity Track
Location :
Scaffold_805:11381- 13682
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_805-snap-gene-0.8Cyclin A
Pytiw_DAOMBR242034maker-piw_contig_805-snap-gene-0.12Lectin

Sequence
2301 bases(100 bases per row)
AGGAGTTCGCAACGTCCGTGCACCGCGACGAGATCGTGGCCGCGATCCTGACGATCGCATCGGCGCTCGGGCTCGCACGAGAGACGCTGCACCTGTGTGT
GGACGTGCTGGACCGGTTCATGGCCAAGCGTCCGATCGAGTCGTCTCGACTGGAGACGCTCAGCATCGCGTACGTTCTCCGTCTTGGCCGCTATGCATGA
TAGGCTATAGTGAGGTAACTTAACTAACCTGTGTGTGTATGTGTGTTGATGTGTTCAGGTGCCTGTGGATCGCAGTCAAGTTCATGGAGACGCCGCTGAC
GATCGTCGAAAAGTCCATCAAGAAGATCCTACAGCAGCGAAGGCACTCGGGCAACGTAAGCCTGCACTGTGCAACTCTATAACCCTCTTTATAAGAGCCT
CATCGCTGACAACCACACGTGTGTGTCTCTCTCTTTACAGTGGACGTGGCAAGAGATCATCGAGGTCGAGACCGAGGTGCTCCAGGAGCTCAACTTCCGG
GTCATGGCGCCCACAACGCTCGCGCTACTGCAGAAAAAGATGTACGCGCTCGACGAGTCGCTGCGTCCCGAGAAGATGCACCTGGCGTACTACTTTGCCG
ACCTTTTCCTGCTCAAAGCCCGGTCGCGCGAGTTCTCGCACGAGCTGCTCGTGGACGCCATCTGGTACGTGCTCTCGGAGCACCAGATCACGGATGTGCA
ACCGCCGCTGCTGGCGCCCGTCGTCATCCTCTTCCTGGCGCACCGGGACAACATCAACCCCAAGCATGCCGTGTTCAAGGCCTGGTTCGCGCTGCGCTGC
CAGTACGGCGCCTTCCTGCTGCAGCCCTGGCGCGTGCCCTACGATCCGTACTGCATCTGCCGCGTGTGTGAGCACGTCCAGGACGCCCAGGACGAGCTCG
AAGAGCTCCTGGAGACTACCGGAGCGACGAACGTGGCGCGCCAGTCCGCCAGACGCTGCCTCAACCTGGTCTGAGGGCGCTAGAAGATACAATAGACCTA
TATACTACGATAGAAGCCCACAGCAGCCGTGGTGAGAGAGTGCATGGATAGATATATGTAAATGAACAAGTTGTACAGTGAAAAATAGAAAGTTGACTTG
CACAATGTGTGCGTGACTCCAATCGCCACACGCACTCCTATGACACCAACCGCCACTACACACCATCCACACCAGCACCAAACTTCCTGTGACTGTGTGT
GCTTGACCTACAGCAGGTGGGACTTGCGCAGGTCCTGGTACTTCTTGTAGCCCGCGGCCACGAGGCCACCGAGCACGAGCACGAGCAGGAAGAAGGGCGT
CTTCCAGCCCGAGGACTTGGCCGCGGTCTCGGCCACGGTCCGCTGCAGGCGCTCGTCCACCTGGTCGCGGATCGCGTTCGCCGTCGAGGCCACGCGCTCC
GTGACCTTGCCGCTCACCCAGACCTCGAGCTCGGCGATGCGGCGCGTGTCCTCGGCCTCCTGCTCGCGCAGCTTCTTGATCGAGTTGTCTGTCGACTCCT
TGAGCGACGTGAACTGGTGCTCAAAGTCCTCGACGAGCTGCTCGTACTTGCGCTTGAGCAGCCGGAGCTTCTCGTCGTTGTCGCCGTCACTCAGGCGCTC
GTCCAGGTCGTGCACCGATGAGTTCTTGACCTTCTCGTCGCCCTCGGCGTGCGCAATGTCGCCCACATCACTAGATAATAGTCAACCAATCAATCACGTT
AGACCATCAGACTATATACCCATATACACAATGCAAGAACGTACTCGAAGACGTTGATCGAGATAATGTCGTGGTTGTCCGCGAGCCCACCGGTGGAGGC
CGTGAGGCCGATCGTGGCGTCGTTGACCCAGTCGAGCGGCAGGTTGACGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTCACCCGTGTTCTTGGCGTCAATGAGGATCGCGACGTAGTTGTCCTTGAATTGGAC
CTTGGCGCGCGACATGTTGAGTGACGCGCTGAAGCCGGCGTTGCGTTCGTGGTAGCGGATGCCCGGCGCCATGCACCCGAGCTTCTTCTCGTCGTTGAGC
TGGTCGAGCGACTTGCTGCCGTCGTTCACGAAGAGCGTCACGTCCTGGTGGCCGCCCGAGTGCTCCGAGTTCACAAACGTGTCAAAGAGCACGCCAAAGC
C