Description :
From Genome Similarity Track
Location :
Scaffold_2:113806- 116203
Transcript NameFunction/comments
Phypl_g85hypothetical protein PHYSODRAFT_247505
Phypl_g86hypothetical protein PHYSODRAFT_490644

Sequence
2397 bases(100 bases per row)
GGCGCGACTACGTTTACTGCACAGGAGTGGGCAAGGCTCGGGAGATCGCGCGTGTCGACCAGTTCGGTCCATGTAAGTGACAACGAGTGGATTGAAAGTG
GCGAGGAGGTGAGACTGAAGTGGCTGGTGGTTTGTTGCAGGTATCCCGCGTGATACGGTTGAGCAGGCGACGGCTAATGGTGACAGTCTGCGCAAATCGC
TGGCGGCACTTTCACCGACGCAGTTCTTGCACTTCCCACAGAACCGCTTTGAAACGCTGTtggacgagttcctggcTGAAAATGACGTCAGTGTTGAGCG
TGGAGTGGAGCTGGAAAGTCTGAAGTTACCGACGGATGGCTCTGCCACACCGGAAGTgacgctgcgccacttgTAAGCTTGCGTAGAATTGTTGCACTGT
TGTGTCACAAGTACTGATGGAGGGCCACGTTGTTTGTGTTTTGGGTGTTTATCAGGGATACCAACAGACTGGAGCAGGAGTCCTATGACTACGTTGTAGG
AGCGGATGGCGCACACAGTCTTGTCCGCCAGCTCTGCGGCATTGATATGGCTGGCACACGTAATCTACAGAGTATTGCCAACGTCCATTTCACAAGCAAG
GCGCTCTCGGAGGCTGCGCGCGAGAATCCAGCTATGTTGTACTTTGTGGTAAGGCCACTTCATGCTTTCACTATCATGATCACGAATGCAGCTAACCCAG
CCACTGCTTTTGATGCTCTTAATAGTTTAACAAGGAAGTCGTTGGTATTCTGATCGCCCACGACCTGAACCAAGGCGAATGGGTCTTCCAGATTCCGTTC
TTCCCTCCCCAGGAATCAATCCCCTGGGACTTCTCTACTGCCCAATGCAAGGAGATTGTACGCCACATCCTACCCAAGAATACCACAgtcagcgacgacg
acatcaaCATTCTATCAGCTGGACAATGGAGAATGGGAGCCCGTGTGGCGAAGCAGTATGATGCCGGTAAGCAACGCGTATTCCTCGTTGGTGATGCGGC
GCACCAGTTCCCCCCGGCCGGTGGATTTGGTATGAACACGGGGCTGCAGGATACGCACAACCTGGTATGGAAGCTCGCCCTTGCGATCCAGGCGAAGGTT
GAGAACTCGACTGCTGGTGCTAGTGGTATCGACACTCAGACACTGCTGAAGTCGTACGGCCGTGAGCGTCAGCTAATAGCGAAGACAAATACGCAGTTCA
GTCTGAGTAATGTGGCTCGAACCATGAAGATTCCACAAGCTGTGAACGTGTCCCACGACAacgcgcagacgctgggGAAGATCATCAACTCGGCACCGAT
GCAGCTTCTCCCGCTCCGTGCACAGCGTGAAATTGCGCAGCGCATCATGCGTGTCGGAAAGCTGCCTCTGGgactgctggacgaagcgaaggatgctgga
ggagccgGTAGCGCCTTGGGCAACTGCATGCGCGCCAGCGTGCAAGATATTGTGACGCGCCGTAAAGCGCTGGGCATGATGTTCTACCACTTCGATATTG
GATTCTCATACGATGCACCTTCATGGGCGGCTCGTGCCAAGAAACTCATGGCAGACCCCGCGCTGGACCAGTCTGTGGAATTTCGTACTGAAGTTGGTGG
TGGCGATAGCATCATCTACTCTCCAGCCTTCCGCGTTGGCGAACGTTTCCCTCATTTTTGGTGCACCAGCGAGGAAAACGCGAAGGTTTCCACTCATGAC
ATGATGATTCTTGCTGTTCAGAGTGACAAGTCGTCCGAGGAAGTTGGCAACGTGCAGTTTGTTCTGGTCGTGGGTGGGCGTGACGCTGCGAAGGTGATCA
GGGCCTGTtcatcttctgcttcgccgACAGTGGCAAAGCACGTGACTCTCGTTGTGCTGCGTTCGAGTGCTGACGGCGAATCGGCAAAGGTTGACGTTGC
TATCGCCGAGGCTCAGAAGTCCTCGACGTTTGGCTCTGTGCTCTCGTGGCAAGTTGTagaggacgagaacgatAACAAggcgtggcgcagcttcaTGGGT
AGCAAGGCTGCCGCTCTTGTGCGTCCTGACGGACATGTTGGTGCACTGTGGGAGACTGACGACATCGCGGACTTCTCTGGTGCCGCCCTCACGCAGTCGA
TGCAGCAGGCTGTCCAGCTCAGCTAAGAAACCCACTCGAACTCCAAGACTTCAAAGCGTAGAGAGCAGAAGCCACAAAGAGAACTTGTCGTGTTTTTGAG
AAATAGAGTAAATTTGTTGATACTACATCGGAGTCATCTATCTACACGATAGCTTCTAGCTCCCGTCTGGCAGGTGATATCTCGCTAAGAGGTTGCAATT
GCCGCACTGGTCTCCGCAACTCCTGGCGAgaagtgctgctggtgtgtACGCTGTTGCTACTGACCGTGACAACAGTCGGAGGCGCTAAGAACGACTC