Description :
From Genome Similarity Track
Location :
Scaffold_1519:1138- 3833
Sequence
2695 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGTGAACTCGGTAAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGG
CGCGTCGAAGAACATTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAATATGTTGGAAGTACGACTGGCAACGGGT
GCCGTCGTGAAGACCGAGAAGCGGATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTTCTGGATCTGGACGATAAGT
TTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCGATTGAGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGT
GAGCGATGGCCCTGTTGCCGCTATGCACACACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGTCGCTGTCCCGGAGCGCCCTGGGCGC
GCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCGGCTTTTCAGCGA
ATCAGGAAGAGTCTCCGACTTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGGCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGC
CAATAATAAGAGCCAAGGTGGCGTAACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTATGTA
ATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCAT
CGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGGTGAACCCGCCGG
CGGTACTAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAGAACGAGAAGACGGCGCATGCGAAGG
TCGCTGCGCAAGTCTCGGTCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTTGAGGCGTTGAACGTCTTGA
CGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGA