Description :
From Genome Similarity Track
Location :
Scaffold_983:1138- 2424
Sequence
1286 bases(100 bases per row)
TGCATCAGCGCACAGCCGATGGCAAAATCGCTCGCGTCGCAGACGACGTGGAATGGCTTTGAGTCATCAGCAAGTTTCAGGATCGGCGCAGACGCCAAGC
TCTTCTTCACCGAGTCGAATGCAGCTTGGTGGTCCGACTTCCACTCCCAGATCACGTCTTTCTTCAGCAGCGAGGACAGCGGCTTGATCAACCCAGCGTA
ATTCTTCGTGTACTTGTGCAAGTAATTGGCCATGCCAAGCCACTGACGCAACTCAATGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGACGATACCTTC
TCGGGATCCGCGCGCACACCGTTCTTGCTCACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGT
TCTCTCGCATCACCTGGAAGACTTGTCTCAGGTGTTTCAGATGTACTTCCACGGCGCTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGAGGTCGTCGAA
GTAACTCGGCGCGAAGTCTCGAAGCGGGCGAAGCACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGTTCTTGAGACCCTGTGGTATCACGAGCCAC
TCCCAGAGCATCCCGCTCGGTGTACTTACGGCGATGAGAGGCACATCGGATGATCTCATCAGGATCTGTTAGAATCCATCGGTCAGGTCGATGGCGCTGT
AGAAGACGCTGCCAGCCATGGAGTCCAGTACCATGTCCTTCCGAGGGATCGGAGTCTGCGCGGGGATGGTGGCATCATTCAACTTGCTGAATACGTGAAC
AATACGCCATCCCCCTGTAGCTTTCTTCACACATAACGTTGGACTGGAATAAGGAGAGGTACTCTCACGCCCTCGAAGAAGTCATCGATCGCTTCCACTT
GATCACGAGGAAGTGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCATGCTGAACCCCACCATCCGCCGGTAGCTCGGCGGG
GATCTCATCCGGAAAGACGTCGGCGTACTCGCAGGCTGTGTCGTTACGGGATTCGCTGATCTCCCGTAAGGCCTCCCAAGTTTGCGTTTGGAATCGTTCC
TCTCGAGCAGACTTAGGTTCAGCACCTAGCGGACGTGAACGTTCACTGTCCGTTGCGACCGCATTTGCTGACTCATCCACCGAGACTGCCTCGGTGACCA
AGCATACTTGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGTTCTTTTAGGACAAGCCTGGAAGGCGTGTGATCGCCGCCGCT