Description :
From Genome Similarity Track
Location :
Scaffold_139:113789- 116002
Sequence
2213 bases(100 bases per row)
CGTTTTCTTTCACATCAATCACTAGCAGCGGCTGCCGGAGATACTGCGCATATGAGCGCAACACACAAGCGTCGGCCCAGTGGGTTCTCCGGACGGATGC
GTCAACCGAGCGCGCGCGCTCATGAAGTAGATGAGTGCAAAGCAGCGCTGTTGAGGCCTCCTTGGTGGGCTGACGAGGAGAGTCCGGGTATAAGCGATCA
AGCATGTCCCCGGGATCGACCAGTCCAAGCGCTGCGTCAGCTGGCAGATTGGACACCATTAGCACGTAAATTGCCTTCTTGTGATAGTTGGCCTCGGCTG
TTGTTTCCGGGGTGCACTTCAGGGTGTTGCCCTGAAAATTCGAAATCGTCGCGTACAGTGCCAGCATCGCACACTGACCGGATTCCGGAACGTGAACTTC
ACGCGCTTGAAACCAGGAAAGCCAGTAATCCGCCTGGATCGGGTTCTGACTAGGTGGCTTGGTACCAATGTAGACCACGCTGTCGTCCGATTGTTGACTG
CTTACCGCGCACTCTGGGACCTCTTGGGCAAGCTCACTCGATCGGAAGTTAGATTGGTTTGAAGCAAGCGAGCATGGCACTTCTGACCCTGGCGTGGCCG
CGAAAGGTGGGTCCTGCGACGGAGCCGACGACCCAATGTAACTGGACATGATTAAACCAGCCTGTGAGGCCTCCTGATGGGCGGCCATATCCACGTCGGC
CGACCCCGGCTGAGAAGGCTTGAGCTCCACGTAGTCAGTCTGCAGTTCGGTCTCTACTTCCGATCGCTGCCTCCGGCTTGCACGTTGAGCACTCCGTTGC
CGCTCTGCACTGCTGATGTCAGGCAGGACCGTAGTAGGCGAAACTGCCTGGGGAATAGGATGATTCGCCGAAGTGAGCGAAACCGCCGGTGCGATGTTCA
CCAGAGAGGAGGTGGGCACCTCTCCAACCTTGCCGTCGCTCTGGTGACCAACGCAGTCCGGGCAAGACTCAGCCATATCCACATCATGTGCTTGGCCCGC
AGTTGGAGCATCCGCGTCCGTTGCATCAGGGAAAGCAAAAGCAGCGTCATCCGGTGCGCTATCCTCTCCGTCCGAGTAGATATCTGCCTCGGATTTCGCG
TCCTCCTCCATTAGAGCTTCAAAGCGGCCAAATTCACGTGCTTTTTGGAAGAGCCTAAAAGCATCGTGATCATTGCGAGGCCGAGGCTGTTTGGAGTTCG
CCGAAGTGCGAGCCTTGGCCGTCCCCGACTTGCCAGTCGGTTTTTTGCTCTCGTGGGGCGGACGCTTTGGTAAGGTCGCCTCAGTCGTCTTCAGTACCGC
TGAGACGGACTTCCCCGACACTTTCTTGCCCTTGTTTGCCTGTCCTGTCTTGGATCGACGCTGGACGACCATGAACTCAGCGTCATCAGGGATAGAACGC
TGCGCAGAAGTATTGCCCGGAGACGCAGCTACGTGAACTGATGGCCCAGCGGAGCGGCCGGAAACCTCTACCGGTGTCTGTTCTCCTGCTTTGGCCGGCG
GCTGTGGCGGGAGGTCAGCCGCCAGCGTTGCACGATTGTCTTAGTCTGGTCGGCTGAAGGTATTAACTCCTTAACCAGGTTGCCCAGGAAGGTGGCAAGA
CTCTCTTCGTCCGAATGATGGTATTGCGTGGCGGATCCCACCTGGAAAGGAGAGACCGTCCCGGTGAATCGGCGAAAACCCCGTGCACGCGCCTCAGAGA
GGTGCGCAGGTCGGACCTTACAGTATCCTGTGGTATGTTTCGGGCTATAACATCTACCACAAGGGTGCCGCTGGTGCAGTAGGTGGTGGTGGAGCGCCAC
TACCGTGTTCCCCACAGCGACATGCGTAACACCCCGTAGTGTAGTTGGGCACGCCTCCTGCGTAAAGACCCGTTGCCTTGCTTCCGCACCAAATGTCCAC
CGCGTCGGAAATATTGCAAGAATCCAGGAGTCTCTGCTGGTACGACGAGAGCGATCCATTACTACGCAGCAAGTTTTCCCTGCAGTAATCCCATCCGCGC
GTCAATTTATCCGCCCTTGATGTAGTGTTGCCCGTAGATCCCAACACCTCGCCCCACTTGTGCAAACTTCAGTGCCGCGAATGTCACAGAGTAGCGAAAA
CTGCACATTTTTATTAACTTGTTCGTTTAGCATTAATCTCACCAAATTTTAACTCGCCTCTCCTTATACGGCACTTGGTTTCCTGCTTCATCGTTCTCCC
CACCTCGATTACT