Description :
From Genome Similarity Track
Location :
Scaffold_337:11374- 12863
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_337-snap-gene-0.11Inositol oxygenase

Sequence
1489 bases(100 bases per row)
TCACACACACGTTCCTGCTTCCTCTGATAATTACCACTGAAGCACCGCTGGGAGGTACTTCTCCGCGAGACTCAGGTAGTGCGGCATCAATTTGTCAGGA
ACAATGTTCTTCATTGCGTCATCCGAAACCGAAGCGTACATGTCCAACGAATGCAGCCACTCTCGTGTTTCGAAGTCATGTGGCGCACACAACTCGTCGT
ACTGGTCGTGCTCATGCCACACCTTCAGCGACCAGAAGCGAATCGCATGCAGTGCTTCCGCAGGAAGTGTCGACTTATTGAACTCCAACACACGGAACAG
GTACTCATCCGGTGTCCACGGCAGCACAACTCCATCCATTCCACTTTGCATCTGTGTGCTTCCATTGCTCTTGATCGAGTTGCAGTGGTCACTATTCAAC
TCATTGAGTTCAGGGTAGCCGACACAGTCAGGAATCGACGCACCGACGACCCACGTCGAGTTCTTTACCAACCACTCATGCGCTGACACACTGCGAAGGA
CCTCATTGTCTTCGTCTGTCCAGCAAAGGAAGAGCATTCCAAGGCCACGCCTACACACATACCATCAACACACAGCAATAGCAAGGTGAGTTTCTTGTCC
AGCGCATAGTGAGAAAATAAATACCAGGTTTGTACACGTACAAGAACACTGCGAGCTGCAACCAATCTGGATGACCGTCATCTCGAACTGCTTGTGCGGA
AGCCAGCATGTACTTCAACACCCAGCTTCCAGCTGCTTCATCGTCGCCATTGAGCCGCATGACAAGCTTGCAGGCGTCCGCGATAGAAAGTGATGCATGC
TGGAAGTCACCATACTTCATGAGTTGTTTTTTTACGAACGACGACGTCTGATACTTGCGCATGATCTTTGCGAACAGTGGCTTTGAGTCTGACTTATTGC
ACACGAGCGACATGATATCACCGCCGTCCCAGGGCACAGGGGTCTCCGAAGACACCACTCTGTTCTTGTCGTGATCAATGCAGAGGTAGCTGCCATGAAA
GTTCTTCAATGCAATGCCACCAGCACTTGTCTTTGCGAGTGACGACGAATCAGCTTCCTCGGCACTGCGACTGGCGTCCGAGTTGTGCGGCACGACTTGG
AACGTCTCCCACGTCGAATTCAGCTGTCGATCCGCGAGGATATTGCCGCTTTCTTCAACGCACAGGAATTTACCGTGCACGCTTCGCAGGAAGATCTCGC
CATTGGCGCCCAGCAGCGTCTGCCACAATGACTCGGGGTTGCTCTTTTCCTTGCGCGCTTCGATGGCACCATCTTCCGAAGCCATGAGGCACGTTCCGTC
CGATGTCTTGAGCGTCAGCATGCAGAACCAAGAATTAGATTTGCTGCTGCTGGGCTGCACAGGGAAGAACGTGCGCGTGTAGAACGGGAGCACCATCGGC
ACCTTGCGGAAACATTCCGTGTCGTTGTACAGGAACAGCACCTTGGCGTCTTGTTTCTCCTGGAATCCCCAGGTCTCGTAGAGCCCCAC