Description :
From Genome Similarity Track
Location :
Scaffold_36:113703- 115253
Transcript NameFunction/comments
Hyaar_Emoy2805195hypothetical protein
Hyaar_Emoy2805196unnamed protein product

Sequence
1550 bases(100 bases per row)
AAACGCGACGGCTCCCAGGGCCCCATCGACAGCGCGCGCGCCTTCCTCGAGTTCAAGCGCGAAGCCGACCCTTACCGCGACGTGGCCGAGCGCGTGCACG
ACTGGAACGAGATCAACAGCAGCCGTCGCCCCCACAACGAGCGCAAGATCCAAGCCGCGCGTTGCATGGACTGCGGTACGCCTTTCTGCCAGACGAACAC
GGGCTGCCCCGTCCACAACCTCATCCCCGAGTGGAACGAGCTCGTGTTCCGCGACGAGTGGCAGGAAGCCAGCGACCGCCTGCACAAGACCAACAACTTC
CCCGAGTTCACGGGCCGCGTGTGCCCCGCGCCCTGTGAAGCCGCGTGCGTCGCTGGCCTCGTGGACGAGCCAGTCACGATCAAGAACACGGAGTACGCGA
TCGTCGACCGCGCCTTTGAAGAGGGATGGATCATGCCCCGTCTGCCCCGACGCAATGGATTGCGCGTGGCTGTCGTGGGCTCGGGGCCTGCAGGACTCGC
AGCTGCCGATCAGATGAACCAGAAGGGGTACCACGTGACGGTGTACGAGCGGGAAGACCGGATTGGTGGCTTGCTTATGTATGGGATTCCCAATATGAAG
CTCGAGAAGAAGACGGTCGAGCGCCGCGTGAAGTTGCTGCAGGACGAGGGCATTGAGTTTGTCACGAACGCCGATGTTGGAAGCAAGACGCTGTCGGTGC
AGCAGCTGCAGACGGAGAACGACGCGGTCGTTTTGGCGCTGGGCTCGACTGTGCCTCGAGACGTGGCAATTCCAGGTCGGGACCTTAAGGGCGTGTACTT
TGCCATGGAGTTTCTGACGAAGAATCAGAAACGCTTGATGCTCACAGTGGACGGGAAGCTCCAGAGTGGCTGGGACCGCGAGTTTGTTACGGCGGAAGGC
AAAGACGTGGTCGTGATTGGTGGAGGAGATACGGGCACGGACTGCATTGCCACGTCCATGCGCCAGCGGTGCAAGTCGGTGGTGAACTTGGAGCATAACC
CGGAGCCGCCAGCTCAACGGGCGCCGGAGAACCCGTGGCCCGAGTACCCGCGTGTTTATGGCGTTGATTATGGTCATGCGGAGGTACGATCGGTCTTTGG
AGAAGATCCGCGGAAATATGCGCGTGTCACGAAGGCATTTAAGGGCAATGAGAGGGGCGAGATTACGCACGTGGTGGCTGTGCGTGGTCACAAGGACTCG
AAGACGAATGTAATTACGGAGGTCCCGGGCACGGAAGAGGCGATTCCGTGCGACCTTGTGCTGTTTGCCATGGGGTTCGTCCACCCCGAGCAGAAGATCG
CAGAGGCTCTTGGGCTGGAGGTGGATCAGCGCCGCAACATTCGAGCTGCTTATGGAGAGTACCAGACGTCGGTCGAGGGCGTGTTTGCAGCCGGCGACTG
TCGGCGCGGCCAATCTCTGGTTGTGTGGGCGATCAATGAGGGTCGTGGTGTTGCAGATGCAGTTGAGAAGTACTTTTTGCAGGAAGGTCTTCACCCTGAG
GTGTCCCAGAGCCAGCGCTTTGGGTGAATGTGACAAGGCTGTTGAAAGGA