Description :
From Genome Similarity Track
Location :
Scaffold_59:1137- 2940
Sequence
1803 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGCGTTTGATACTACACCATAGACTCATCGACAGCCATGAAAGAATCCACCCACGCTTTCAATTGTTTCCATGAGGCTTCCAGCCTGTTGTTTG
TGTTATTTCCGAGTGTCACCGTATTTTGGCGCTTATACGCAGACCACATCTCACGGCAATTGTCCCAATTCCGGCGAAAGTATGCCACAAATGGGTGTTC
TTCGCCGCATCGAACGGGTTCTCTCGTTGGCGTCCGGTCTGTACCCGATTTCGCATGCCCAACTGTGCCAGACTCACCCCCGACTGACCCCGATTGACGG
TCGTCTAAGTTCGGTTCACTCCCAGTTGGCTCCGGCGCATTAGACGTTAGGACGTAATAGCCAATTGACGCGAGGCGGACCATGTACCGCAAATGCTTCT
CGTATTCTGCTTCAGTCTTTGCGTACACCAGTAAACTCATCGCACCCCCAAGTTTCTCCTTCTGGGTCTTCGAAAATCCATAGTCAGCCGAGGCAACCTC
TTCACGTAGGTATTTCAGTACGTGAAATTGGCAGAGCAAAATAGTCACTCCAGAAAAAGCTTCTTCCAATACTGAAATCTCCGTGAAATCCTTATCCACA
AGAATACACTGCAGCCTTTTCCACGCTGGATTATTAACTTTTAATTCCTCCAGCGCCGTCAGTAAGGTAGTGTACCGCTCGTTTTGAAGCAAAGCGTGCT
GGACGAACTGCCCCTTGCCAAACGTGTCATGAGCCATAAACGAAAAGACCTTGTACTTAGACCGATTCGTTCCGTGGGTGCCTCAGCTAGAACCTCCTTC
TCGTGGAAAGCTTTATCTGTCATCGGCACTTTCACGTTTTTGTAGCCGGGATTGTTCTTTCTGAATGTATGGAGAACCAGACGGAGATTTTCTTTGGTTT
CCCGTTCAACCAATGCGTGTTGAGCGTACTGACCCTACGCAAACATCAAATAGGTTCGTTAACTGTCGAAATGATTCCATATAAACATTACTAGTGTACC
TTTCCAAAACAGTCATGCACAACAAAGCTGAAAAGCTTGTATGCGTTCGTGTTTGTGTCGTGAGTTGTATCTACCATTACAACTTCAGGAAAAGCTTCGA
AAAGTCTTTTCATCCCAGACGTTTGAAAGACCACCGCTACAGCCACCTCTCTGGTGGTGTCCACGAATATCTTTGCCGTGTTCCCCTCGTCCTGCTTCGT
AAACTCACGTAGCACGCTTTCGGTTCTTTCAACGTCTGTAGTTGACCCCTTTGCTGCATATTTAAGCTCCTGCAGCACGTTATGCACATCTTTGAGCTTC
GTTTTCTTCCCTATATGTAAATAAAATCACACACAAAAGCATTAAGTAATTTGTGGAATTAGTCAGCCTCTACGTAGATAACCTGTCTGTTTGCGGATCC
AAGCAAGAATGCCTTTAGGCGAGGAACCAGCAGCGCGCATGTCAGAAACTGTGGCGAGTAGCGCGGGATCTTGAATTGTTCGATTGGCTGCGTAATAGTC
CCA