Description :
From Genome Similarity Track
Location :
scaffold_1320:1137- 2161
Transcript NameFunction/comments
Pl_100860hypothetical protein PHYSODRAFT_498916

Sequence
1024 bases(100 bases per row)
TCGAAGCCTGCGTTGGATCTAATGGCGTACAGCAGCTTCTTGCGCATGGCCTCTCTGTTGGAGTACGCTGGTAGTTTCAACAGGTTCATACATGTGGCAC
TGGATGGCAATCGCTCGTCATCTTCAACACGTACCTGGTGAATGCAGATCTGTGGTACCAGCTTCGAGAAGCCCAGCAGTGGCTGGCGAGAGCAACTTGT
GATGAACTTAAGTAGCGCTGCACGGTCTTCGATTGTGAAGTCCTCTCGTACGATTTCCCAGAACCATTGAATGATGCGTTGAGATGGATGGTAGCCACCA
CCATAAACCGTGTTGCGTTCCCAGTCGTCGATATCGATATTCGTGGCAGTGCCACCGATGAGCATTTGCAGTTCAGCAGGAGCAAACATTTGGATCCACG
TGCCGGGAATCAAGTCACGGAAGCCCTTGAGGAAGGCAGCGCTCTCTATGGATGACAACACGTTCAATTTGTAGTTGGCCATCAAGTGGATGTACCGAAT
TCGGTTTTCGTTTGTCACGGGGATATTGGCTCCATCGGGTACTAGGTTCCGTGTTACCACTTCACCGAACTCCATCTCGCTTACGCTGAATGTCAGCGCC
AAGTCCTCGACATTGCCGTCGTAGTGCTTAAGTCGCATGAGTGACTTATACAACTCTGGGTCCAGCGAATGCAAGTCGTCGATGTAATTGAACTTGCCAA
GCAGTTTGTTCAAGAAAAATGCCGCGAATTGTGGTTCCACCAGGATGTTCTCGTATACAGCCTTTGCGAGAACACGACCAAGGAAGCGATAGCGATCCAG
AGCCTCTTTACGCGTATCAACAATGTATCTTGCACCGGGGTTTGGATACAGGAGGTACTCGTCCGTTTCCAAGAAGAAGCCGTACTCTGGAGAGAAAGCG
TTCTTTGTCAGGTTGTCCATGTACTCTTTGAACACACCTCCACCATCAATACCAGCCTCCTCGAGTCCTTGTTCATTAATGAACGTAACCTTGACGCGTG
ACTTGAGAGCCGCGGGAGACATTG