Description :
From Genome Similarity Track
Location :
Scaffold_6:113682- 115342
Transcript NameFunction/comments
Phypl_g295putative glycosyl transferase family 48 protein

Sequence
1660 bases(100 bases per row)
GTGGCTGCTAGCGTAGAAACGGTAGAGCTCATCGAAAGACGAGTGCTTCGTAACGAAACCACGGCCGGTCGCACGGTACTTGGCGCCACCAGCAAGAATC
GTCTGGCCGAAGTAGAACCACTTCGTGCCAATGTGAAACAGGAAGTACAGCGGACCACCCGTTACGAAAAGGACGAGGATTTCGCTCAATGCAGCCTTAA
AGCCACGCTCGACTGAAatcgtcgccagcagcggcgcagTCGTGAAGAACGCCACCGATCCCAGCATCAACTGCAACTTGCTCAGCAACACTGGTTCACG
GCCGCCAACACCCTCCAACGAAAGCaacgcgcgcagcaggttgcAGTACAGCAGAATGTACACCGTCCAGATGATGATACATGTCGACAGGTAGAAGCCC
ACGTGGTTGTAGTAAAATGATAGCAACTTGAAGAAGTCCAGACGCTGACTAATGCGATACACATCACGCGATAGCGACTGTTCCGCAGCACCCTGTGCCA
GCTTTGCCTCGAACTTGTAGATCTGTTGCATACCAACATCACGTCCTTTGCCACACTTCGTGTACTCCGGGAAGGTCACGGATCCACCACGCATGCAGTT
ATTGTAACCAGCGAAGATATCTTCGCTGAGGTTGATACCCTTGCTGGCCTTGCTGATGCCACCACGCGTAATGAAGAAAAGCTTGTTGAACACATCGGGG
TGACCGTAGTGTAGACGCATACGCAGCGGACGCGCCAGTGTACGCTGGCTCAGTGTCACGAAGGATGTCTCCTGTAGTGCCATGTAGTTCGCCAGTGAAC
TCACGCTGCCCGTGAAAATGTGTTCCGGAATACCCACAATCGTGTACGGCCGGTCAGCCGTACCCTTGTCGAACTCTTCGAGCAGGTTTCGCATCTTCAA
TCCCTCCTCGAGATATCCATCCTGGTTCATGTCGATTGTCTGCAGATTTTCGCCGCGAGTAAACACTATGGCCGAGTTCTGGTTCTCAGGCTTACCCTCG
CCCAAGATAGGGTTGCCGGGTAGACGCACACGGTAGATCTCATGCACCGATCCAAGGTCCTCACCACCCTTGATGAGCACTGAGAAATACGACTGCTCCT
TCTGGTAATTCACGCGTACCTCATCGATGTAAGCGACGCGTAGGTTCGGGAATCGGTGCAGCAAAAACTCAATATCGCTTGCCTTCGGGtcgttgttctt
cttctgccgGCCATAAATTTGGCAAGCCACGACGTACGTGAACTTCGTGTTGATCAGCTCCTcaagcttctgctgcggAACTTGCTCGATCTCAGCTAGC
AGGCGGATAGCTGCTTCGCCGTACATCATACCCTGCACCGTACGCGAGAGGGTCTGCCCACGCAGAGAAGCCCACATACGCAATTCGATAGCAGTTTCAG
GGTCCTTCCAGATattcttcttcggcttcacTCGCTCCAAGAAGTTCTCCCAGTCTCGCTTGTACAGCGTCTGCAAGAATAGCAGCGTGTGCACGTCCAG
ACCATCCTGTTTGCTTTCCAGATCTTTTCTGGAATACAGGACGTCTTCGGCATAGAACGGGGTCATGACGCTCCACGACTTCATTTCCTCGAGCAACGGC
GCCAGCGGCATGTCCATGAACAGCGAGTTCACGAAGAACAGcaagcggcgacgagcgtCG