Description :
From Genome Similarity Track
Location :
Scaffold_8:11367- 13212
Transcript NameFunction/comments
g3309.t1XP_009537319.1 hypothetical protein PHYSODRAFT_319446 [Phytophthora sojae

Sequence
1845 bases(100 bases per row)
GTTGTTCACGCACCACGTGGAGACTGACGGCCAGTGTAATCAGTGTGGTGGTCGCCATTGCTGGACACCACGTGAGCAGTAAACACCTCACTTGCCAATT
AGGCACTCTCCGATCACTCACTTCACGCGCGCCATGGAACCTCCCCAGTACAACCGCGCCTTCCTGGCCAGCAGCGCTGCCACCACCTCTACGATGGTTG
GCCCCCTGTTCACCCGAGGTCGCGTGAAGAGAGGGTTTACCAGCACAGATTGGAGGCACACCACCCGCGTTGCGGAGACCGACCCAACCGTTCGACTGTC
ATCTCCGACTGCACCATCCGTGGCGACGCGACGGGTGCCAATACCAATACCAATGCCAATGCCAATGCCAATGACAATGCGACTGCCAGCTAATCGCTCG
GTGGTAGCAGACCCCCTTCGCTATATGGCTGATCCCGAAACAACGCGGCAACGTAGCATCGTTGATGGCGTCCGTGACTTTGGTCGTTGCGGTGCGTACT
TGGTGCCTAGCAGCGCAATCGTTCGACGGCGCAATCCAAAGCCAGTGGGTCATGGCGGCAAGCGAAAACCTGTTCGTCTGAAAACTGCTCGTCGTCGGGA
GCAGTGCCGCGCCAACCAAGCACGCTATCGCTCGAGGCAAAACGACGCAGTCAAAGACCTGGAGGAAGCCGTCTCGAGATTGAAGCAAGAGAAGCCATTG
CTCGCGCTGCAGCGAGATCGAGCGCTCTACAGCACCAAGCACAGCGTGTTTACCTTTGCGATGGAGTATTTTCACCTCTTTCGCAACGGACTACATGCTC
CGGCCCACCGCGCGCAAACCGGTCGCGGCGAACCAAGTCCTACATTCCAGCAGCAAGTCGTCTTTCTACGATCTTCTTTGGCTCCTGACGTCATGCTAGG
CAAACACCAAGGCGTGGAAGCACTCATGGAGCAATGGCGGCGGTACTCGGCGTATTTTGACGACTTGTGCTTTCAGCTGGACCACATGACGGAATTGTCG
AAGGACCTCGTCCAAGTCTCAGCGTCTCTCAGGGTGACAGCGACAAACGCAACGTTTGAGAACGTGTTCCCGCAACTGCTGGCTGAGGAGCGAGGATACC
GCAGAGACGATGCGGAAGACCTCAAGGCGGCCGAGCTAGGGTCGAAGCTGCTCGGACGGCGTCTGCTTCTTCCTTGCAGGTTGTACCTCGAGTGGGACGA
AAGTAGCTGCCAGCTCGTGCGCTTAAACATGGACGTGGACTTCCTGGCACCAATCAGCCGCGTGTTGAATTCGCTGGAGGATGCTGCCTACGTCTTAGAC
CAGGCCCTTATCTCTGTCGATGGTTCGATTGGCAAGCGCTTCAGTTAGGCTCAGAGCTCCTAGAACCTTAGCTTAGTACACGTACATTTGAAGTGAAGTC
TGCTCTTCGCACAACACTGTGGTACAACTAAATCGGACTATGGATACGCCTTAACCGACCATGCACCAGGTTGTGTGCGCTTGAATAACACGCTGGCGTT
GCCCCTGCGGTGCAGCCTAGAGGCTACTGAGAAGCAAAAGCCGCCACCTTATCTGCCAATTGGTATTAATACAAGCGGTCAAAGACGGATTGCAACACAC
ATAGGACGTTCGTGTGTGCGTCATCACCAGTATCTCGGCGTTCGGGGAACTTGATAATGTACCTCGCGAGGTCGTCCACACTGTACTGACCACAAAAGTT
TCATCCCAAGACCGTGAACGAAAACAACTGTACCATTGGCGAGGTACGGTACGGTTGCTAGCCTCAACGAACAACAGCAGCGTGTCTCGAAGCAAGTGCT
TCCCGGCACGGATACCCGTCGCATGCACGGTCGTCTGCACGGTTC