Description :
From Genome Similarity Track
Location :
Scaffold_1179:1136- 2770
Sequence
1634 bases(100 bases per row)
GCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATG
CTGACCGGTTCGTATTGTCTGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGATACGACCACGGTTGGCAAGCGGAGACCAAGCTGCGGCTTGT
GGTACCAACAACGATGATTCAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCAACGCGTTAAGTCC
GATTATTATTGGATCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACT
CACCTGGTAACGTGCTAGCCGGACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACGGCGTTGCTCCT
ATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCACATACGACTGCACTGAGTGTTGCCCAAGTGGTCGAAGAATGTGTGGACTGACGG
TTCGGAGCCCCATCATTAATAAGGCATGACCGCGACCCACGCTTCATGAGCGAGGTGTTCCAAGCGTTCGCAGAGATGATGCAGTCAAGATCAAGGGCGA
CTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGGAGCGCTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGA
TTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAAAAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCG
CAGTCGACGTTGCGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGTGAGATCAATCGACAACATGAGG
TCGCCCTTACTATGGCCAAGGATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGCATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACC
TCAACCAAGTGGAAACGAAGACTCGGCGGACCCTCCAGAAGCTTCGGAAGAGATGGAAGATCCTGCAAGAGCTCCTCCGAGATCTCTTTTTGAGATTGGG
AGCCAGGCGTGGCTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACCGATGACATGGACCTTTTCGGATCAAGCGCAAGGTGGAAG
AGTTTGCGTACGAGCTGGGAACTGCCTGATCGAAGTGGATATCGCTTTTACCCAGTAGTGCATGTGTCAAGACTCAAGACTGGTCAACTATTTCAACAGT
CGACGAAACACTCGGTTGGTACTTGAACGGCGAACTAAATGATAGGCAGAACTGCGACTTGATGAGAGAAACTAACTGACCTGAGAGAACAGCTTGGAAA
CAATATCAAGTTGACCGGTGAAATATGAAGTCGAGGCCATCCTTGGACGACAGAACCACCACTAACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAA
GTCAAGTGGGTGGGCTATGAAGATACAACTTGGG