Description :
From Genome Similarity Track
Location :
Scaffold_14:113591- 115097
Transcript NameFunction/comments
Aphin_H310_14481FolateBiopterin Transporter (FBT) Family putative

Sequence
1506 bases(100 bases per row)
CAGTACGCGTCGATCGGGATCGTGTACGGGATGCTGCCCCAACTCGCGTACCCCGTGTATGCAGTGTATCTGCGCCTCGAAGGATACCAAGTGAGTTCGT
ACAGCATCTTGGTCAACATGGCGTGGTCGCTAAAGATCTTTTTCGGCATGGCCTCCGACTGCATTCCGATCGGGGGCTACCGCCGCAAGCCATGGATGGT
CCTGGGGTGGTTGATCTGCTTTGGCAATTGCCTCTTCATGGCGCTATATCCATTCAGTCGCCCGTATTGCGACCCCCCCGCGACCGACCTGGTCGCGGTC
GCGCAATGCCAGAATCGGTCCTACCCACCGAACGCTCCGTTCCTCAACAAGGGCGCGCACTCAAACTTGTACACGTTCATCGTACCGTCGATGCTGGCGA
GCGTAGGCTACGTCATGTCTGCCTGCGCGAGCGACGCCATGGTCGTGCAGTACGCCCAGCGGGAGCCCGCCGCGACGCGTGGGCGCACCCAGACGGCCAT
TTACGTTGTCCGCACCATGGCGACGATCGTGTCGCAGCTCGTGGTGGGGTTTTGCCTCAATGGCCGCGAGTACGGCGGCGAGTTTTCGTTTTCGCTCCCG
ATGAACGTCATCTACGCCTTCTTGTGCATCCCGTGCGTCCTGGTCACGATCGTCACTGTATTTGGCATCCACGAGCACCAAACCGAGCGCGTGCCGTTCG
CCAAGTACATGGGCGGGTTGTGGTCATTGCTCCAGAAGCAAGCACTGTGGCAAATCATGGCGTTTCGATTCCTCAGCAACATGTTTCAAGGGTTCAGTTC
GACGGCGATCCCGACCATGTCGTCCGAATGGGTCCAGCTCTGGCCGATCGTGGATTCCGTCTCGACAGCGTTCGGGTCGGTCATTTTTGCCAGCATCATG
ACCGTCGTCGGCAAATACGGCCTCCAGTGGAATTGGCGGTGGACGATTGCGCTCTCAACGCTCGGCCTCGTCTCGCTCGACAGCGTCGTGTACATGGCGA
CGATCTGGGACGTGTACCGGAACCAGTGGTTCTTCACGGGCGTCGTCTTGGCCGACAACATCCCGACGGGCGTCCGGTTCATCGTGAGCATCTTTTGCGC
CGTCGAGATTGCCGACCTCGGCATCGAAGGCACCGTGTACGGCCTCGTAACGACTGTCAACAACCTCGCGACGCCCGTCGCGGGCGTGTTGTACAAATGG
ATCGACGCGTACTTCAAGGTCACGTCGGACGACATCAAGACGGACACGACCGAGATTCGGTGGCATGTGACGTACACGTTCTTGATTGCGTATGCGATGA
AAGTGCTGTCGCTCGGGTGGCTCTTCTTGCTGCCGCCGCAAAAGGCCCACCTCCAGCGCCTCAAAAAGTACGGCCACAAGAGCCCGGTCGCGGGCGCCGC
CGCCGTCGTCCTCTTTCTCGCGTTCCTCGTTTTCTCGATCACGACCAACTTGATGTCGATCATTTCGTCCACAAGGTGCTATCGCATCGCGGGCGGCAAA
GGATGC