Description :
From Genome Similarity Track
Location :
Scaffold_19:11358- 16432
Transcript NameFunction/comments
Physo_536379Hypothetical protein

Sequence
5074 bases(100 bases per row)
CTTTCCATCGTGTGCTTAGTAACGTCCTAAACTATTATGTATGTATTAAATTCTTATCACTGTCCTAAATTATGATCAACCCTAATGTAGTTATAAATAG
TCCCACCGATCTACTTACGTTTGGACAAAAGTTCGTTGACATCATTCATGCAATGTCCGGCGACTTTATTGATCTTTTGGGACGTAGGATACCAGCCTTA
TATTCACCCCCACCATGCGCGAAAGGTTTTGAGCAGCAATTCCCATATGCGTATAAACCCGCAGTGAGAGCGAGTTGCAACCCACATTTTGCTTGCTAAC
GCCTATTTTCGTCACACTAACCACGGGTGCTGCATCGGTAAAGGTTATGTTTCGTTTTAACTCCTCTAGCCCCGCTTCCTATTTTCTGCAAGGTAACCAC
TTTTCTTATCCTGTATACTACAGTATAAGAGTATAAGAAATCAGGCATAGTTTAATCTAATTATTCTATACAAATGTCAAGTCACTTCCACCGATCGCAG
GATTAGGAAGGATTTTGCTAAGCTCGGGGGGGGGGTATAATTCGTTGTTCAAGATTTTTCGACATTTCGGGCTTTCGCGCCGTTTGCGAATCGGAAAGAC
ACGGAGCACAAGAGACAGAAGCTCGCAACAAAGAAACACAAGCATGCGAAGTTGCGATACCCAGTCACCGGTACGTGGTTTCAGTATTTTCCGCTGACGC
GTGACGGGGTAACGTTGCTTTAGTACTCTATGGCTTAGCGTCCCAGCCCCCCCCCCCCCGGACAGGTCGAAGGGAAATACAGCCCACTGTACGTATTTGA
ATATATTCTGCGAAGGGTTGGCGTGCAAATATCGATGCAATGCTGCTTGGAAAGCCTTAGCGACGTGATACCGACCCTCTTCTCGGTGGTCAAGGTAACT
ACTAGTCAATACGGTGTCTTTGACGGTTAGCTAACGTTTGCTAAGTGTGATGCTGCACACAGCGGCTTGATCGATAAATGTCTGGTCACGCGGGGCCCCA
AAACGCGGCGCATAACACCCCCCTCCCCGCTAAAGAATGCATTCGGCCATAGCAACGACGAAGTTACCAAAACGATGCCTATCCTTCGGCTGAAACCCGA
CCCTCAGCGTAGACGGCTCCTTGGTGTGCGTTGCCGCTGGTCCATAGTGTTACTGGTACGCTTCTACTTATTATATAGGATACAGGATTACAACTAACGT
TTTGTGCGATTAGTCGGTATAGTCGAGATTAATCAAGATCGGCTCAATCGCGAAAAGGCAGTCGGATACATTGAACGTGGCACCGCATCATGTAGCGAGG
GATCGCCAAGGGCTTCTAGAAATATGTTTATTTAGGTAGGACTACTTCTTTTCAAGAGTGTTAGTGTTATTCATCTTTGTAGCAAGTTCAAGCGTCGTGG
CTCACATGGTATAAAGATGGAAGCTTTGCATCACTTAGAAAGCTGGAGTTCGAAAGAGACGAGGCTGTGAGAGCCAATATAACCGATACAAGTATTTAAT
CTCGCTCTCGACACAGAACTTATTTGCGAAGAAGCAAGAATTTCCCAACTGCACGAGAGCTGGGGATACGAGAGGATGCGACGTCGTAAGGATTCGATCA
AGTCGCATGCAGCTCATTGTCCAACACCATCCGTGCTCGGCGGCTCAGCATCGAAGACTCGGTTCGATTTGTCCGAGGCGAGACAGATCAAGATACCAGA
CCGAACAAAGCATTAGACACCGCTCGATTGGTTAAGTCCTTCGCGGATATCCACATCTCGAAGCACTCGTCAAAATTGCGCCGCATGGTGTCGAAGCTCA
GTGGTCATCTACACCACCAGCGCGTCGACCCCTTCCCCGAAATCATGGGTCCTGTGTCGCCATTTAAGAGCAGTCACAAAAAGCATTCGTGAAGACCAAG
ACTGCGGGCAGTACATGGTAGTTGAAGTCGACATTCTTTCGCACTGGCCGTCAGTGATACGCAGCCCACTAGGTGCCGTTGAGAAGAAAGGTGTCGACCC
GTCGATTGAAGTGAGGACAATTCACGATTTGCCTTACCCTGAAGGCGAGTCAACCAACTCCTCCTTCAAGATAGACTCCGTGCCAACGATCAAGTACGAG
GCTATCACAAAGATCGCCCGACGCATTGAATATCTCGCGAAACAGGGTGACCCCACTTGCATCCGAATTCTGAAAGGCGATGTACGCGGTGCTTACAGGC
ATCTTCGGACGATTGCGTCTCAAGTGTTTCGGATGGCCGCCTTCGTGAAGGAGCTGAACATCTTGTTGATCGACCTCACAGCACCTTTTGGATGGGCCGG
CTCTCCACCGTTTTACGGGTTGTTCGGTCGAGCCATCTCATGGCTCATGTCAACCAATTCCCCGGCATCAGTATCTATATCCGATGACAATGAGCCTTTC
TTCGGCTACGAATGGGTTGACGACCATATCCTAGTCGAACTTGACGTTGGAGACCGGCTACACCGAGCCGAATCTACGTTGCGCCACGCCATGCTCGCAG
TGCTCGACCCACGATCCATTAACGAAGCTAAGTTCTCGGGGTGGTACTCGGAATTGGTGGCTCTAGGATTACTGTGGAACACAACTGATCAGACTGTATC
AATTCCAGCTGATAAGATAGCGAAGGCTCTTCAACAGGTTTGAGCCATGTTGTCACGACGATCCACAACGAAGACGGAGCTTCAAAAGCTTTGGGGTCGC
TACGTCACGTTGGAACTTGTGTCAGCACGTCGAAACCTTTTTATCAGCAGCTTCATTCGCTGACATCAAGAGCACCTCGATTTGCATGGATGCAATTATC
CGACGGGGCCGTGCAGGATATACTATGGTTTCAGAATATTCTAGCCTTCGGTCATCTCGCAGCACTCCCCGTTAGCATGTTTGGCAACCTGCCAGCGCCC
AACGTTGAGCTGTACATGGAATCGTCAAATAGCGGACTTGCAGTTCTCGATCCAGCGGCTTCTAAGTTTACCCAGCTGAAGTTTGATTCTGACGAGGAGA
TCCTCATGGATAGCAGTACCTCGCCGGACCATCACTTCTCCATTAATGTGCGCGAACATTTGTGCATGGCTCTAGCACTCTGGACATGGGGTCCAATCTG
GTACGAATCGTCCGGCGGCAGCATGGTGCACGTGAAATGCTGGAGCGACAACATGTCAGCAGTGCAGTGGTGCAATCGCTTGCACTCCAACAACGCACTC
AGTCAAGAGATTAACAGGGCCATTGGCCTCGCTGAAGTCTACTTTAACCTTCGAGTGTCGGCTGATCATTTGTCCGGGTCAACCAACTGGATGGCGGATA
CAGCATCACGAGCCTGGACGGAACCTTTCAAAAGACGCTGGACTAACTTTTCTGTGTCATGGCAGCGATCACCGGAACTTTTCAGCGAGCTTAAAGCCAA
ATCATTGGCCTCGACGTCGGCCACCAAATATGCCGGGACCTGGTTTCAGTGGACGAAGTGGTGTCAACTTCTGCACTTACCGGAGTGGCTCCCCGCAGAG
CGAGCGCACCATTCATATCAACTCGCCTTTTTTGCTACCTACTGCTGGAAGTTCGGATGGAGCAACTCCAAGACAGGCAACTCTGCCTCAACCGTGCTCG
CCAAGATCAGCCGCGTGTCGTGGTATCATCGGCGATTTTGCAGGATACAGCGTTGGACTTACCCCAGGACACCAGCTCGCCATCACTGGTATGCGCCGAG
AAGATCCCCCGACAAACCCGAAATTACCCATCACACTACAATTCCTCAAGAGCCTGCACAAGTTCCTTAACTTCGACTTCGCCCAGCACCGACTTTTGAG
GAAATCAGAGTATTTAGCGGATGGGGCCAAAGTGAAATCGTACGCGATCCGAAGGACCGATGTTCGCTTTTTGGATAGCGATGATCACGAGCAACAGGAA
CTGAAGCGCGTTCAAAAAGTTCAAATTCGATTCCGCGGGAGCAAAACGGATCAATTCGGCGAAGGCACCACCAGGACACTGGAAGATCGGGCCTAAAACA
GTGCTGCCCCGTCCAAGCGTGCTGGTACCTGGTTCAGCGCCATAGCTCGCTAGGCGTCGATGCCGACACGCTTCTGTGCAAGGTGTCCTCTTCGCAAAAC
CTGCAAGCCCGAGATCTAATTGAGGCCATCAAGGGTGCCGCGAAAGAGAACGGAGATACGCCAGAACGATTTGGATCCCATTCGCTGCGCAGTGGTGGTG
CTACCGCCCTATTCAATGCAGGTTTCTACAGTCTCGCTGTGAAACTGTGGTATAGTACCCCGCGGAAGAAGTGGGCGCGCCGGGCGCCGGAGGAAGAAGG
CGCCGGGACGCGAGTGATGGACTTCGACGCGGCTGATGGAACGCGACGCAGGGCCGAGCTCGACGGGAAAGTCGGCGTCGGTGATGACCGTGAGACATGG
TGCCAGAATCCAGTGCGACGCGTAATCATCCGACGGGTCGACCAGCGCACCCGGTTCTGCAAAACGCGCCGACCTTAAACCCCGCCAAACAAAACGCGCC
GAGGTAAGATCTTGATCGCGCCATGTAAAACAGGTTGAAGCACGGTACTGCAAGCACGACAGAAGTAAGGATAGGCACAAGGCTTAGCAAGCAGTGGTAG
GGAGTAGCCAGTAGCAAGGACATAGGATAGGGTAAGGACTCAGTCCCGAAATTTCTCTGAACCACAAAGACCTCCCGTCTTCTCCGAGGTTCCAGGGGAA
CCACCAAGCACCGGCAAGTAGAGCCGCCTCGATGTCGCGGCCCCCCGTCGTTTGCTAGTTTGGGTGCTCACCCCCCCCCCCCCCCCCACAGACCCGTGCT
GGAACAAAGGCACGTTAAACGTATAACGTTTAGGTGGGCGCCCGATAACGCGCTGCCTAGGCGAAAGGCCGCACTGGCCTGATAACCGCCGTGCACAAAA
AAAACCGTGTAGGCCCGATAACGCCACACAAGCCCCAGGAAACGCCGGCCCGATAGCGCCGCACGCCCGACTGGAACGCCAAGGAAACGCCAGCCCGATA
ACGCCTCACGCCCAAGGCTCGACGCCCTACGACAAGGGACAAGCGTCAACACAAGAACCCCCCAACTCTGAAGC