Description :
From Genome Similarity Track
Location :
Scaffold_755:11356- 14160
Transcript NameFunction/comments
Phypl_g10776phospholipid-transporting ATPase, putative

Sequence
2804 bases(100 bases per row)
ggagcaggagctggggGGCAGGCCCACGACGAGGCGATCCGAGAGGTCTATTTCAACTACGCACCCGGCAACGCCACGTTCGACAAGTGCTCGAACGTCG
TGGTGACGTCCAAGTACAACATGGCGACGTTCGTGCCCAAGTTCCTCAAGGAGAGCTTCACCAAGGTggccaacttcttcttcctcatgGTCTGTGTGCT
GCAGAGCATCCCGAGCATCAGCAACACGTACGGCTACCCGACGAACGCGCCCGTGCTGTTCTTCGTCATCTCGATCGACGCCGTGTTCGCGGTGATGGAG
GACCTGCGCCGCCACAAGTCGGACAACGAGGCCAACGCGGCCACGTGCCACATCATTCAGCACGGAGAGATCGTGGACCGGAAGTGGGCAGACATCAAGG
TCGGAGACTTCCTGCAGGTCCGCAACCGAGAAGTCATCCccgccgacgtgctggtgctcgccGTGGCGGAGCCCGTGGGCGAACCGCCCAGCGGCATTTG
CTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCTGCggcaggcggtggcggccacCATGAGCTCGCTCGCGAACGCGgccgagctcgcg
ctgctgcgcggcgtcgtcaagTGCGAGCAGCCGAACCCGCACATCAACAAGTTTGCAGGCAAAGTGGAGGTTACGGTCGGTGACGGCTGCGGCGTGGAGG
TCATGCCGCTCTCCGtcaagaacgtgctgcttcgtggcTGCAATCTGCGTAATACGGACTGGGTCTTCGCACTCGTGCTCAACACAGGAAACGACACCAA
GATTATGCAGAgtgccagcgcggcgccgtccaaGTGGAGCGACCTCATGCTGAACATTAACCGCATGATCGTCATGTTGTGCATGGGGCTATTCGTTGCT
TGCGCTATGGCTGCTACTTGCTACATCACGTGGCAGTACGACATCGTGCGGAACACGTGGTATATTCAGCTAACGGAGACGGAGAGGAACCGCTCGCGTT
TTGTGGCCTTCATCCAGATGATGTTCTActacttcttgctgctctaCCAGGTGATTCCCATCTCTCTGTACGTGTCCATGACGAGTgtcaagttcctgca
gtCGCGCTTCATGTCGTGGGACCTCGAAATGTATCATGCCGAGACGGACACGCCTGCTATCGTGCGAACGATGGAGTTGAACGAAGAGCTGGGCCAGATC
TCTTACGTTTTCAGTGACAAGACAGGCACGCTGACGTGCAATGTCATGGAGTTCCGTAAGTGCTCCATCAATGGCATTTCGTACGGTTCAGGTATCACGG
AAATTGGACGCGCAGCACTCGTTCGTGCTGGGAAGCCCATCCCTCCCGAGCCCAAGCTGGACCCGAGCATCAAAACGATTCCGTTTGTGAACTTTGTGGA
CAAGATGCTGTTCGACGGAATGAAGGGCAGCGCTGGtgaggagcagaaggagaagatctTGCAGTTCTTCGAGCACCTCGCAGTTTGCCACACCGTGATC
cccgagaagctcgagtcTGGCGAAGTTCGTCTttcagcgtcgtctcctgATGAGCAGGCACTCGTGGCTGGCGCAGCCTTCGCTGGATTCAAGTTCGAAA
GTCGTAGTGTAGGAACGGCGAACGTGGAGGTTCTGGGACAGCGCGTGACCTACGaagtgctggacgtgctcgagTTTAACAGCACGCGTAAGCGTATGTC
AGTCGTCGTGCGCAAGCCGAccggagagctgctgctgtacacCAAGGGAGCCGACATGATGATTTATCAACGCTTGAAGGATGACccagcgatgctgaag
ctcaagaaTACCACGCGTGACCACATGGAGAAGTACGCTGATGATGGTCTGCGTACGCTGGCACTTGCTGTCAAGACCCTTGATGAGCGCTGGTTCCAGC
AGTGGAAAATGCGCTTCGATGACGTACAGGGTAACGTGGCTGAAATTGACCGACGCAAAGATGGCAAGCCAAATGCTATTGACGATTTGATGGAGGAAAT
CGAGGAGGGCTTGGAACTGATTGGTGCGACGGCTATCGAGGACAAGCTACAGGATGGCGTTCCGCAGTGCCTAGCAAACCTTACGCGGGCGGGTATCAAA
GTGTGGATGCTCACGGGCGACAAGGAAGAGACTGCTATTAACATCTCGTACGcttgctcgctgctggacaactcTATCCAGCAAGTCATTGTGAACGCCA
CAACGTGTCCAGATGAAGCAGCGATCCGCGCAAAGTTGAACACAGCGGCTCGCGAGTTCATGGATAGTGCGAAGGGCATGGCAGGTGGGACAGAGAAAGA
AATCTCCCTGGTTATTGACGGGGAGGCATTGGAAATGGCACTTCAGCCAGGAACTGCACCACACCTGCTATCGTTCGCGAAGCTGTGTCGTGCGGTGATC
TGCAACCGTGTGTCACCTGCTCAGAAGGCTGAGATGGTGAAGCTCGTCCGGGATAACATCAAGACCGTACGGACGCTAGCTATTGGTGATGGTGCCAACG
ATGTCGCCATGATCCAGGCCGCTCACGTCGGCGTAGGTATCTCTGGACAGGAGGGCATGCAGGCTGTGAACTCAAGCGACTATGCCATTGCGCAGTTCCG
CTTCCTCGAGCGGTTGCTTCTGGTTCATGGACGTTGGAACTACATTCGTATTTCCAAGCTGGTGCTGTACATGTTTTACAAGAACATCACGCTTGTGCTG
GCGCAGTACTGGTACGGTTACCTCTCGGGCGCCTCAGGCTCGAAGATGTACTGGGAAATCGGTGTCCAGCTGTACAACGTCGCATTCACGGGTCTGCCAA
TTGT