Description :
From Genome Similarity Track
Location :
contig_187:11353- 14372
Transcript NameFunction/comments
g11985.t1hypothetical protein

Sequence
3019 bases(100 bases per row)
TCCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTGCTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGAC
ACGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGAGCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGG
AAGACCATGGACTTGAAACGACTGCTGAAGACGAAGATATTGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCG
GAAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGACACCTTCGGTGTCTATCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAA
CACCTCCCGCAACGACACACCTCCCGCGACGACACCTCCCGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACA
CCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCGTGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCAGTACGTTAAGATGACTGCGGAG
GAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACAGCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGA
AGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATGCGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGG
AGTGGAGGTGAAGACCGTTCAAACTTACACTGGACGCCTGCGAGTGATACTGAAGCGGGTGAACTAGCGCGTGAAGTTGAAGCTGCTAGTGTAGCAGGTA
GCTGAATTAAGGGGCATGCTCTAGTCTATCTCTAAGTCTCAACAAGAAAGTCATAACCTGCGCGTGGTGTGTCGGATATATGTCTCTCAGTGAGCGAATG
CGGAAGAGCGGCGAGGCTCTATTTGTCGGCATCGTCGCAACTACGTCCACCGACAGCGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGCGACGCGT
CTTTCTACAGCGCGGTCGGTGACGAGAGTGGGCTGGTCGGTGGCGCAGTGGACGGTGGGCGGATCCACTAGGGGTGCGGTTACACACTGTGGATCCGCTC
GCCCCCGTTTTGGCCCTTTCCGGACCGGAAATGGGGCCCGAAGAGCCTCCACGTGCGGTGCCGCTGCTCGGCACCGGCGACGCTTCAGCGGCTGCAACTT
CGGGCACGGGTCCGGGACCCGCAGCGCCCATTGCACCGCGACCCCTCACGCGCCTCGAGGCCGCTGCCGGCCAAGAGACGCCCCGCCCCGCCTCCACGAC
CTCGCGTCGTTTCGGGATCCACCGGCGGATCCACCGTCCGCTGGCGACAGTGGACGGTCCGCTGGTGCGGGCGGGAGGTCGGCGCACCCCTCCCCACTCG
GCCCACTATCGGCCGAATGCTGGCCTCTCAGGCCGTACGTGTAGCGGGGCTACACATTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATAC
ATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAG
GGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAA
GCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCA
CACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGA
ACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCG
GAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTG
TTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGT
AAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGC
CATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTC
AAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAG
CACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTA
TCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCA
CGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAA
CGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTA
TCGTCACGGGCAATCAAAA