Description :
From Genome Similarity Track
Location :
Scaffold_399:113525- 114880
Transcript NameFunction/comments
Aphin_H310_13417peptidase putative

Sequence
1355 bases(100 bases per row)
CCAGTTGTTCACGAAGTTGAACGCCCACCACGCCGACTCGCGGCTGTACTGGCTCTGGAGCACAGTCGTGTAGGACGTAGGTACTGTGGATTGCGCACAC
GAAAAAGGAACGTAGACAGCGCCGTGCGGAGACGACAGGCCGTACCACATGACTCCGCCGATCGCATCAAATGGAGCGGCAGGGGATGTTTGATGTACAA
AGCTGTATACGGTGCGCTCAAGCGAAATGGCGCGCTCCCAGCCGCCGTCAATGCCATGTGTGGTGCCACCATTGCGATTTGGGTTGCCCCACGGACCTGC
TGCGATGCCTTGTGTCAAATCGAAAGGCGTGCCTTCGTAGTGGTCCCGAAGGAGGGCAAATACGTCCGTGACAGAGATCGGGTGGTCGGGTCGGACCGAC
AAGGGGTATGTGGCCACCGTCGGGTAGAATCCCAGCTCGGGATGAAGCTCCAGCGACGGCGCCACGACGTCCATTATGCGCCACAGACGGCGGCCGACGT
ACAGCGGAAGAAGCGGGCCTTCCTTGGAATACCCATACGCAGCCGTGAAGTCAAACGGGCCATCGATGTCGGGGTCCCACCAACCCTGGTCCCGTGCAAA
CGTGTGGACATTCGTCGACGCAAGAAATCGAGTACTGTCGGCCAAGTCCATCTCGCGGATGATAAAGCCGTTCGCGATGGCTGACACGTGATCATCCTCG
ATGCGCTGTGCAGCCCAGACGGCGCTGCTGTTGTCAGGCCCGGTCAGGACATGGAATACCCACGCTTCGCCGTACTTGTCCCCAATCGCCAACGCTTCGC
CCGAGCTCATGTACACAGGGTGCGTTGAGTTGCCGTTAAAGTCGTTGTAGAAGCCGTACTCGACGGCTAGGTCGCCCATCGTTTTGACTGCACATCGCGC
GTTGTCACACCGCTCGAGGGCAATCTTCGTCAGTTCGTTGATGCTAAACAAGTTCTTTCCTCCAGGTTGCCCCAATGGCCACCCGACAGTCTTGGCGCCA
CACGAACTTTCACCGATGGCCAGCTGCTTCTCGTTGATGAGTCCGTAGTCCTGGTCAAAATACGCAAACGTGTGCTGGACTTGAGGGATGCGGCCAAGCG
GCGTCGACAACGATTGATCGTCCACGGGTTTGTACCAGTCACCGCGTTCGTTAGTTACAACGCGAGGATATCCTGGACGAGCGTATGAGTAAATGCTGCG
GGTAGACCCATCGGCGTGGTCCATCGCGGGAACACGCACCAAGCGCAAGTCCATTGCCCCAAGTCCCGTGTCCTCGGTGTGGGCTACGAGCACGGTGCCA
TCCACGGTTGCATTCTTGCCGGCAACAATCACCGTGCATGCTTGAACAGCGGCAA