Description :
From Genome Similarity Track
Location :
Scaffold_363:11352- 12734
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_363-snap-gene-0.20Dicarboxylate/amino acid:cation

Sequence
1382 bases(100 bases per row)
TCGTAGGCTTCGTCGACCTGCTCGGCGATGATGCGCGCGACGTACGTGTCACCCAAGACGTTGCACATGGTGTTCATGCGGTCGATGTACCAGTAGATCG
CAACGAGGTAACTGTACGTCACGGGCACGTCCTCGCTCGGGAAGATTGTGCTCCAGATCGAGTACACCATCACGAGCCCGGCATTCGGGATCGGCGCGAC
TCCGATTGAGCCAAGCAGCGACACAAGCCAGATCAAAAAGATCTGTACCCAGCCGAGCTCGATTTGCGACGTCGACGTCTTCGCGAGGAAGATGATCGCG
TTTGGGAAGAACATCGCCGTACCGTTCATGTGCGCGGTCGAGCCGATCGTGACCACGAACTGCAACAGCCCGCGCGACACTTCGCGCGTCGACTCGACGC
AGCGGATCGTGATCGGCAACGTCGCGAGCGAAGACGCGCTGCCGAACGCGAACGTCGCAGCGGGGAACATCATGCGCATGTACGCGAATGGGTTCTTGCG
GATCAGCACGAAGATTACGATCGGGTAGAACACGAGCTCGAAGAGGAACACGGTGATGAAGTTGCAGAGCACGAGGATACCGACGTGGGTAACCGCTTCG
TTCATGGAGCTCTGTGTGGAGAGCGAGCCAGCGACCAGCGAAAGCACCGCGAGCGGGCTCCAGTCGATCACGCGTGTGATGATGAAGTAGAAAATCTTGT
TCATCTGGTTGAGCACGTCCAGGAGCGGGCTGTTCTCGCGGGAAGTCGCACGCGTGGCGGCAGCGCCGAATGCGATAGAGAACATGATAACGCTGAGCAG
CACGCCGTCGACGAAGCTGATGAAGATGTTTTTCGGGAACAGCGAGTTGAGAATCCCCGAGAGCTGCTCGGCGACCGTGATCTTCGTGTTCGTCCCGGAC
TTGGTGAGCGCGAAGTCGAGGTCATCCAGCTGGAAGAGCGTTCTGTTGCCCATTGCGGGGGCTGAGCAGTTGAGGTCCTCGGACGAAGTCATCTCGAGGT
ACTTGCCGTTGTCGCACAGGACGTTAAACCACGCAATTTGACTGGCCTTGGGGATGAAGTCGACGTCTTTGTGCAGATTCCGCAGCATCATCGCGACCGC
GAGAGACAGCATCGCTGCAGTCGCCGAGAAGAGCACGAAGAATAATGCAGTGCGTGTGCCGATCGTTGACACTTTGCCCAGTAGCACGATATTCGCGACG
CCCGTCGAGAGACTCGCAAACACCATCGGGATCACAAAGCATTTTAGCACGCGCAGGAAGACTCTTCCAGGGAGATCCACCAGCGTACTGACGTCTTTTG
AGACGTTCAGGTGCGCGAGCAGTGCGCCGAGTGCCGTTCCGAGGACGACGCTGAGCAGGATCTGGACCGTGGGCTTTCTTAG