Description :
From Genome Similarity Track
Location :
Scaffold_2382:1135- 5107
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2382-fgenesh-gene-0.1Nardilysin

Sequence
3972 bases(100 bases per row)
ACCGTGAGGCTGAAGCCCAGCACGCCGTGCGTGTCGCGCACGCAGCACGAGACCTCGTAGCCGAGCTGCTGCCGCGTGCGCAGGTGGTCGAAGAGCGGCT
CCGTCATGAGTTGGTGCAACAGCTCGGCGTACGCCACGTCCTCGTAGCCGCATTTGCCGATCTGGTAGTACACCTCGACGGCCGAGTTGGTCTCCTCATC
GTGCTCGCTCATGTCGCGCAGCAGGATGCCATTCGTCGTCACGGGCAACTCGGTCGTGTGTGGCGGGATCAACGACTGGGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACTCAGTCGCTCACTCAGGAGCTTCTCAA
CCTGGGTCTGGAGATTAATGGCGCCCGTCCGCGAGCTGTTGCCGTGGATGAGCGTGCGCATGGCCACGTCCCCACCCCACATGGCCTCGTCCCTGAAGCG
CACGATGTCTTCGATCTCAACCTCAGCAAGTGCGCGGATCTTGTCCTCGACCGAGAACGTGGCGCGCTCGAGCAGTTGCAGCCTCAGGTACCGGGCCTTC
ATGGCCGGCTTAAGGTTCAAATTGCGGTACTCGCGCACGAGCTCGTCGCGCAAAACCGTGAAGGTCGCGGATGTGATCTCCGCGGCCACGAGCTGCTGAA
AGACCATGCGCACCAGGTCGCCGAGCTTGTCGCTGAAGCCGCTGAACGAAGCCTCAATGTCGAGGTCGCGGATGCCAATGTCGAACGCTAAGTTCGCATT
GCTCGCCTGGTACGCGGTCTGCTTGAGCGCGTCATTAACGATCTTGAGGTAGATCGTGGCATAGACGTAGTTTGAGACGGAGTGTGTGAGGGACGGCAGG
CAGACGAGGAAGTTCACGTTCGTCTTTGGCACGCAGAATGTCGCGTCCTGTTTGAACCAGAGCTTGCTCAGGCGCGTCGTGCGCACGAGTTGAGGCCCAC
TGCCCTTGTCCTGAAGTTCGCACGAGGTCTCGTCCTCGCCGTCGGCCTCGAGGGGGACAATGTCGAAGCGCTGTGGCATGAACCGGTTGCGCGGCGGGTT
CTTGAGCACCCTGTGGGGTGAGGGCACGCTCCATTTTGCTAGGAGCTCATTGGGGATCGTCGACTTGGCATACTTGGCGCCAAACCACTTCTCGGTCGTG
AAGTCCAGAGGCGTCTTGTGCTCAGGAGTTTCGTTGACCTCGTCAAACGAGTGCGAGAAGAGCAGCACGCGGGTGTTCGCGGGCGTCATGTGGTCCAGCA
GCGCGCGTGTTGGCACCTCCTGGAACACGCCCTGGAGCGTGTCGTAGCGCAGGAGATCGCCGCGGGGGCTCACACCGTGCCGGTCCTGCATCAAGTGGCT
CAGGCGGCGACAGAGCGCGATGGGTTCGTGCTCTTCCTGAAACAGGAAACTCATCTCATTAGACGCCTTGAGTTCCTCGAATATCCAGGGCTCGAGCGAC
TCGCTGGCTCTGGTGAAGTGGAGCACGTCGAAGATGACCTGGACGACCTCGTCCCAGTGCTCGAGTCCGATTCTCGTGAGCGTGATACCCACCTCAAAGA
GACTCCCAAACGAGCCAAACTCGTAGCTGTCGCCCTCGGAGATGCCCGCAGAGACGTATGTGGCCCAGCGCCGGCTCTTGAGGACCGCTGTCAGCGAGCC
CTCGCCCTCATGGCCCAGGATGTGGGATAAATAATCCCAGGGCTTCTGTCGATAGCTCGTGAGCAGGGGCGGCAGCGCCCAGTACAAGTGCATCGAATGC
ATCTTGCGTACGGGCAGGATCTTGATCAGCGTCGGCTCTTGGCCTGCAGCGGCACCGAATGGCGCTCGTGGAGGTCCTGGGATGGTGGCAATTGAGGGCC
CTTCAAGCCCACGGATTTTGCCGAAAGACTTAGCGACCCAGGCCTCCATGTCGTCGAGCGAGTCTTGGCCGTAGACACAGAGCTTCATCAAATTGGCTGC
GTAGTGGCGATTGTAGAACGCGATCATGGCCTCCCGTACGTCGATGCCCTGGGCCGATGGGATCGTCTGCAGACTCTGCGTGTTGCCCCAGCTGAACGTG
TCGTACGCATGGCCGGGTGCGCAGGTTTCGCACTGAATCTGCTGCAACCGCACGTAGTCGTTCTGCAGCGCGCGGTTAAACTCGGACTCGACGGCGAGCA
GCTCGCGCTCCATGGCCTCGTGCTGGAAGAGCGGTGCGATGAAGAACTGCGCAAATATGTCGAGCGCGTGCTCGAGGTGGCGCGGTCCGATCTCAAAGAG
GAAGCGCGTCGACTCGCACTCGGTCGCGCCGTTGCTGTAGCCCCCGTGGGTGCTCAGGAAGGACTCGAACTCGTTCTCGTCCGGGTACTTAGCACTGCCC
ATGAAGAGCATGTGCTCGAGGTAGTGCGCAAGGCCCTTGAGGCTCTGCGGGTCGGCCATGCTGCCGACGCCTACGGTCATACAGGCAGCAGCATGGTGCG
TGCTCACAGGCGCCTCCTCGTCGTCGTCGTCATCATCGTCGCTGTCTCCATCGCTGTCGCTCTTGGTGCTGAAGAAGCTGTGGCGACGAGCTCTGGTGGC
GTTAGACTGCGCCAGATCTGGCTCAGGCTCGCTCTCAGGGTCACATCCGTCACTATCACTGTGCGTAGTCGCCTCGTTCTGGATCAACAGCGCCTCGAGG
CCGTTCGACAGCGTGACGACGCGGTAGTTCTTCTTGTCGGCCGGCGAGCGGGCGGCGTTGAGCGACACGCTCGTTGTCGCCATGTGTAAGGGTGTTGTGA
CTGTGGCTGCTGAGAGGTCCGTGTGGAAGTGAGCGATGCAGAGCGATCACTCGTCAGCGCAGGAAGGAGCCTGCGTCTCTGACCCATTCCTTCTTCTTGC
GTCCTCGATTGCGATGGTGCCCATCAAAAAAGAAAAAAAGCTCTTCGATATTTTCTTTTTCCACCAATCAAATTGCCAGAAAACGTCAGGAACGAATGCT
TTCAACCAATTAAAATGGCGGCAAGAAGCCGAAGCCTTTTCTCAATGCTGAAGCTGAGGTCACCTCGGATCACCACCACCAGTCTTCTGAGTCAATGCAC
GCGCATCTAAAGATCATCGCGAGGAGATCTCTGCCCAGATGCCCAAGGCTGCGATCCCGTCTGGCCAAGTGGCCGACGACGCTCAGCAACGCCCAGCGCA
TCTGCAGCGTTCGCTTCACGGCTACGACAAGCTTCCCGCTGAATATCTCCAGGTGCTGGCGCTCATCATTGCGCCATCGACCAGAGAATGACACGCGCTC
CAGCACGCGATTCAATCGAAGTCGGCGCGAAAACGTCGCCAACTCGCCCCGGAATGAACAGCCGAATCCGCGGATGTGCAGCTCCTTGAGCGAGTTCATC
ACTGCGTACCACCAATTCGTTGCGCTCGCCAGGATTGCACAGTGCCCAGTCCACTGTGAGAGACTTAAGATTGGGCAGCGTGTGCTCAGCGAAGAACTGC
TGTAGTGTTGACTCGCAAAGCACCACGTAGTTTGCGGCAAGTACGAGCTCGAGCTTCTTGAGGTTCGGGCAAAGCGACGGCACGTCGTGAAGAATCGAGT
CAGCGAAAATCGGATCGATCTTCACCAGTAGCGACTCCAATACGTACCCAACGCGATCAACATTGACTGATCCTCCCGCACCGAGAGGCTGCCATCAAGC
TCCAACACTGTCAACGGCGACAGCTCTTCCTGCAACGATTCCCACTGCTTGACCTCTGCGATATCGTGTACTTGGACCCATCCAAAGCCAAAGCAGCGCC
GAGTTGCAATCGGAGCGACGTGAATCGCAGCGTTGGTCTTCACTCGCGCGACTTCACCAGGATTTAGAGCGT