Description :
From Genome Similarity Track
Location :
Scaffold_89:113439- 114483
Transcript NameFunction/comments
Physo_140735aminophospholipid-transporting P-type ATPase

Sequence
1044 bases(100 bases per row)
CGAGTTTGACGCAGCAAAGAAGGCGCTATCTAACCGCGAGCAACTGTGTGTGGGGGTCGCCAGGCAGATTGAAAAGTCGACCAGACTGCTGGGTGCTACT
GGAGTCGAGGATCTGCTTCAGGACGGCGTACGCGAGTGTATTTCTCAATTGTCCCTCGGAGGTATCAATATCTGGATGCTCACAGGCGACAAGGACGAAA
CTGCGATCTCCGTAGCGCACATGTGCGGCCTCATCGGTCCCAAGAGCAAGATGATCATTATCAAGGGGAAGAATAAGCAAGACTGTCTCGATGAGATCGC
TAAAGCTCGTCGGAAGCTGAAGAGGGAGGGCGTTTGGGTCCCTGGCGTCGCATCGCAGGACATTTCGCTGGTGATTAATGGCGAGGCACTCGAGCACCTG
CTAGCAGACGCATTGACGTCAAGCACGATCAAAGCTCAATCGTCTTACGTCAGCTCAAACCAAGTGGCTCCACACTCGAGCAACACCAGCCACTCAGACC
CGGCCTTCCACGCCAGCGCCACTATGGACATGCTACGAAGCGAGCGGGATGCACATGGAGGGCGCTTGAGCCGCTCGATGTCTTCAAAATCCATGGGAAA
TCTCCCTTTCCAAGCGGCTCAGATGGTGCAGAACTCGCGGCATCGCTCGAGTTCCAGGCCGGGAACAACTAGATCCTCGATAACGGAAACCAATGGCGGC
GCACAATTGGCGCACGAATTGTTTCTCGAGCTTGCGTCTCAGTGCCGAACAGTGGTGGCCTGTCGGTTGAGCCCCATGCAGAAGGCCCAAGTGGTGAGCT
TGATGAAGTCTGCACCTGGTACACCACTCACGTTGGCAGTGGGAGACGGTGGCAACGACGTGAGTATGATCCAAGAAGCTCACGTGGGTATCGGCATCTA
CGGACACGAAGGAATGCAGGCAGTACGCGCTGCCGACTTCGCTATCGTCACTTTTCGTGACTTATCGCGACTTTTGCTGGTGCACGGACGCTGGAATCAC
CGTCGAGTGGCGCGCGTCATTTTGTTCTCCTTCTACAAGAACAT