Description :
From Genome Similarity Track
Location :
scaffold_324:11343- 12876
Transcript NameFunction/comments
g7264.t1 DNA replication licensing factor MCM5
g7265.t1 hypothetical protein PHYSODRAFT_332802

Sequence
1533 bases(100 bases per row)
CGATACTGGTTGCCAATTTCTCGTACAAATTCGGATCTCGAGCCATTTCATGGAACTTTTCCTCTTCAGCAGGAGAAAAAGTGGACTTAGCACGTCCTGC
TCCTTCTTCGTCGATCTCAATACCTACCACACGCAAGTACAGAGTGCGGATGGCTACAGCTCCGACGTTTCGGCCGCCTGCATTGACGACTGAAGTGATG
CCGACCACCGAAACGCGCGTGCCGGGGGATGCTCTGTCGACTAAGTGACGATCCGCAATCAGCGCCAAGTTACGTGGCATTTCACCAGTAGGCACCACTT
CCGGGTTTTCCTGCAACTTAAGCGTTTGTTGGTCCACGTATTCTCCTTTGTCTGGCAAAACCATGTACGAGTCTTTCGGACAGCCGTCCCCAGGGGCAAG
GTTCTCTTCCTCCCGGTTGCGATCACAGATACGGGGGATGCTCACGCCACCCATTCCAGAAACGGCGACGCGCTTAGTGTGGCCACAGTTGCGGCATCGT
AAAGTTGCCGATACACACTTGGTGCGCACTCGAGTGGCACTGATGACAATTCCGGGTACTTTCACCAGGCGGTTGATTTCCTGGGCGTGAACATGGCGAA
GCGCCACTGGGGCTTGGTCACTGGTGAGAATGGCTTGAATGTCTGGCAAATTTGACGCGCGAAGAGCTGCGTTATCAGACGCATCGGCAACTGCCTCTTG
CCCTTGCGTGCTGGCGACGAGCAGTTGCGCCAACATTTCCTTGGCTGCATTTTCCAGTAAAGGTAATTGTTCTTTCGGGTTCTTCAGCAATAGATCTTGT
AGTTCCTGGTCGAAGGCGGCAACATGCGAAAGGTTCACAGTCACGACCCAGTGGTGGCGGCGGGCGTTGGCCAGGAGCTGCTCGCGGTAGTAGAAGAGCG
GACCCACGCGGAACCCGCGCAGGAAGGCCAAGAGACGACGCTGCAAGGCCGCCGGACTCGCACTCTGCCGCGCGTCCGACGCCTGCGCGCTTTCCATGCC
CACGGCCGACACGCGACCGGCATCCCAGTCCATTGTTGTCGCTAGGTTTGATCGAAGAGTCAACGGCTAAAAAAGCGCGGGAAAGGACCCATACACAATG
TATACACAATTAGGAAATATCCTAGTTTTGTATCTATGAATGTGATTGGCTGATGAAGTTGAAGACGTTCGAGGATGGAGGATGGAGTCTTATCGGGTTT
AATCTTAATCTTGACAGGTAGGAGGAATACACTCTCCGATTTCCTGGCGCATTGCGAAGTTCCTACTACTGCAAGATGAAGGCGCGATTCACAGTGAACC
CGTTCGAGGAGCTGAACTTGACTGCGGCCGACAAAACGTCGCTGCAGGACCTCGCCAACCAGGTCATCATGTCCAACCTCGGAATGTGCATGAAGTACAT
GAACAACAAGCTCAAGGTGGATCTGAGTCACTGGAAGCCGCTGAAGGGCAAAGACAACGTTCAAGTCTACTCGGAGCGACCTGAAGCTGTGGCTGCTGCC
GTTGCTGCGGGGAACGAGCCGACCGGGTCAGGA