Description :
From Genome Similarity Track
Location :
Scaffold_737:11343- 12567
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_737-snap-gene-0.15Protein phosphatase PP2A regulatory subunit B

Sequence
1224 bases(100 bases per row)
TGCGGCATCGAGTGGCGCCGAGGCGCGCGTGGTGTGGGTGACAGCGTAGTGTCGCTCCGGCCGTAGCGGTCATAAATATGGAACTCGCTGTTGTATGAGC
CCGTGATGAAGTTGTTCCCGTCGCCGCTCACCGCGCACTCGAACTTGTCAAATATGCAGTCGCTCTCGTACAGGTCGCCCAGACGCGGACGCAGATGCTC
GTGGATCTATTCGACATTGTTGGGAGGTAAACAATTTTTTTAGAAATTGGTTCTCGCCGACAGTTTTCACAAAAAATAATACTTACGTTGATCGTCTGCA
CGGGTCGTGAGTCCATGTTGACGTCCCAGATCTTGAGCGTGAGGAAGTCGCGCGCGATGATGTAACGCCCGTCAGGAGAGAACTTGATGTCGGAGATCGA
CGCAATGATCTCGGAGAAAAAGCTGCGCGCCTCGGGGTCTTCCTGTTCCTCGTAGACTAATAAATAAAATTTCAACAATGTCAAGAAAAAAATATATAGA
AAATGTCGACGCCAATATTTGAGACCAGACCTTTGCAGTACGAGTCGCAGAGCGCGGCCTGACGCATGTCGCCGAGCTTGATCGCGCCGCGACTGGTGCT
GTACATCATGATGTTGCAGTGCGACGGGTGGAAGTCCGCGGCCGTGATCACCTCGGTGAGCTCCTCCATGTTCTTCGGCTTGATGTCCACGATGTCTGTT
ACAACATATCGACGATTCTCAGCCACCCATATTATCATACAACCGACAAATGATGGACGAGGTAGGTCATTACGTACTGAAACTCTGGTCCGTGCGACAG
AGGCTCCAGAGGTTGACGCGCAGGTCGTCGGCCGACATGAAGGTCTCGCCGTCGCTGTTGAGCGCGATCGAGTTGATGTGGTACGTGTGCGCGTTGGCGT
ACACGCGCTTGGCCGTGCTCGCGGTCACGCGGTTGCGCACCGAGCACTGCGGCAGGCGGATGCCGCTGGGGCAGATCACCTTGGCGCGACCACCGTTGTT
AGCCGAGGCGGCCGCGGCCGCGTTGTACTGCGTGACCTCGCGCACGTTGCGCTCGCAGACCTTCCAGAGCTTGATGGTCTTGTCGTTGGTCGAGAGCAGG
TACTGCGCGTTGTTAGACGCACGGCCCCACTTGATCTGGTTGATCTTCTCCTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGA
AGTCCGTGTACTGCGAGTACTGCG